ID: 1055984042

View in Genome Browser
Species Human (GRCh38)
Location 9:82037392-82037414
Sequence CCATTTATGCAGAAGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055984042_1055984050 10 Left 1055984042 9:82037392-82037414 CCTTCCCACTTCTGCATAAATGG No data
Right 1055984050 9:82037425-82037447 TCAGAGCATTGAGGTTTCTGGGG No data
1055984042_1055984048 8 Left 1055984042 9:82037392-82037414 CCTTCCCACTTCTGCATAAATGG No data
Right 1055984048 9:82037423-82037445 TGTCAGAGCATTGAGGTTTCTGG No data
1055984042_1055984047 1 Left 1055984042 9:82037392-82037414 CCTTCCCACTTCTGCATAAATGG No data
Right 1055984047 9:82037416-82037438 ATGGCTGTGTCAGAGCATTGAGG No data
1055984042_1055984049 9 Left 1055984042 9:82037392-82037414 CCTTCCCACTTCTGCATAAATGG No data
Right 1055984049 9:82037424-82037446 GTCAGAGCATTGAGGTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055984042 Original CRISPR CCATTTATGCAGAAGTGGGA AGG (reversed) Intergenic
No off target data available for this crispr