ID: 1055984049

View in Genome Browser
Species Human (GRCh38)
Location 9:82037424-82037446
Sequence GTCAGAGCATTGAGGTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055984042_1055984049 9 Left 1055984042 9:82037392-82037414 CCTTCCCACTTCTGCATAAATGG No data
Right 1055984049 9:82037424-82037446 GTCAGAGCATTGAGGTTTCTGGG No data
1055984044_1055984049 5 Left 1055984044 9:82037396-82037418 CCCACTTCTGCATAAATGGCATG No data
Right 1055984049 9:82037424-82037446 GTCAGAGCATTGAGGTTTCTGGG No data
1055984045_1055984049 4 Left 1055984045 9:82037397-82037419 CCACTTCTGCATAAATGGCATGG No data
Right 1055984049 9:82037424-82037446 GTCAGAGCATTGAGGTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055984049 Original CRISPR GTCAGAGCATTGAGGTTTCT GGG Intergenic
No off target data available for this crispr