ID: 1055986303

View in Genome Browser
Species Human (GRCh38)
Location 9:82058926-82058948
Sequence CAGCTGGACAGGAGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055986303_1055986312 14 Left 1055986303 9:82058926-82058948 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1055986312 9:82058963-82058985 GACCCATGATCATTCCAAGATGG No data
1055986303_1055986317 27 Left 1055986303 9:82058926-82058948 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1055986317 9:82058976-82058998 TCCAAGATGGGATCCCTCATGGG No data
1055986303_1055986313 15 Left 1055986303 9:82058926-82058948 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1055986313 9:82058964-82058986 ACCCATGATCATTCCAAGATGGG No data
1055986303_1055986319 28 Left 1055986303 9:82058926-82058948 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1055986319 9:82058977-82058999 CCAAGATGGGATCCCTCATGGGG No data
1055986303_1055986309 -8 Left 1055986303 9:82058926-82058948 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1055986309 9:82058941-82058963 TCCAGCTGTAGGAGCCTTCAAGG No data
1055986303_1055986316 26 Left 1055986303 9:82058926-82058948 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1055986316 9:82058975-82058997 TTCCAAGATGGGATCCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055986303 Original CRISPR CAGCTGGACAGGAGGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr