ID: 1055988841

View in Genome Browser
Species Human (GRCh38)
Location 9:82083465-82083487
Sequence ATTTATAAATCCTGCTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055988841_1055988848 24 Left 1055988841 9:82083465-82083487 CCTGAAAAGCAGGATTTATAAAT No data
Right 1055988848 9:82083512-82083534 ATATAAATGGGTGATGGGCTGGG No data
1055988841_1055988845 18 Left 1055988841 9:82083465-82083487 CCTGAAAAGCAGGATTTATAAAT No data
Right 1055988845 9:82083506-82083528 TGGTAAATATAAATGGGTGATGG No data
1055988841_1055988843 11 Left 1055988841 9:82083465-82083487 CCTGAAAAGCAGGATTTATAAAT No data
Right 1055988843 9:82083499-82083521 TGTAATCTGGTAAATATAAATGG No data
1055988841_1055988849 29 Left 1055988841 9:82083465-82083487 CCTGAAAAGCAGGATTTATAAAT No data
Right 1055988849 9:82083517-82083539 AATGGGTGATGGGCTGGGCACGG No data
1055988841_1055988846 19 Left 1055988841 9:82083465-82083487 CCTGAAAAGCAGGATTTATAAAT No data
Right 1055988846 9:82083507-82083529 GGTAAATATAAATGGGTGATGGG No data
1055988841_1055988847 23 Left 1055988841 9:82083465-82083487 CCTGAAAAGCAGGATTTATAAAT No data
Right 1055988847 9:82083511-82083533 AATATAAATGGGTGATGGGCTGG No data
1055988841_1055988842 -2 Left 1055988841 9:82083465-82083487 CCTGAAAAGCAGGATTTATAAAT No data
Right 1055988842 9:82083486-82083508 ATTCAGATATCTTTGTAATCTGG No data
1055988841_1055988844 12 Left 1055988841 9:82083465-82083487 CCTGAAAAGCAGGATTTATAAAT No data
Right 1055988844 9:82083500-82083522 GTAATCTGGTAAATATAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055988841 Original CRISPR ATTTATAAATCCTGCTTTTC AGG (reversed) Intergenic
No off target data available for this crispr