ID: 1055988844

View in Genome Browser
Species Human (GRCh38)
Location 9:82083500-82083522
Sequence GTAATCTGGTAAATATAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055988841_1055988844 12 Left 1055988841 9:82083465-82083487 CCTGAAAAGCAGGATTTATAAAT No data
Right 1055988844 9:82083500-82083522 GTAATCTGGTAAATATAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055988844 Original CRISPR GTAATCTGGTAAATATAAAT GGG Intergenic
No off target data available for this crispr