ID: 1055988847

View in Genome Browser
Species Human (GRCh38)
Location 9:82083511-82083533
Sequence AATATAAATGGGTGATGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055988841_1055988847 23 Left 1055988841 9:82083465-82083487 CCTGAAAAGCAGGATTTATAAAT No data
Right 1055988847 9:82083511-82083533 AATATAAATGGGTGATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055988847 Original CRISPR AATATAAATGGGTGATGGGC TGG Intergenic
No off target data available for this crispr