ID: 1055991500

View in Genome Browser
Species Human (GRCh38)
Location 9:82111138-82111160
Sequence CCATCCGGAGGCTCTATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055991500_1055991509 27 Left 1055991500 9:82111138-82111160 CCCTAGATAGAGCCTCCGGATGG No data
Right 1055991509 9:82111188-82111210 TGATGCAATGATACTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055991500 Original CRISPR CCATCCGGAGGCTCTATCTA GGG (reversed) Intergenic
No off target data available for this crispr