ID: 1055991507

View in Genome Browser
Species Human (GRCh38)
Location 9:82111169-82111191
Sequence ATCAAAATCAAGATGGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055991507_1055991510 4 Left 1055991507 9:82111169-82111191 CCTGCTACCATCTTGATTTTGAT No data
Right 1055991510 9:82111196-82111218 TGATACTGATTTTGGACTTCTGG 0: 11
1: 41
2: 100
3: 210
4: 586
1055991507_1055991509 -4 Left 1055991507 9:82111169-82111191 CCTGCTACCATCTTGATTTTGAT No data
Right 1055991509 9:82111188-82111210 TGATGCAATGATACTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055991507 Original CRISPR ATCAAAATCAAGATGGTAGC AGG (reversed) Intergenic
No off target data available for this crispr