ID: 1055991509

View in Genome Browser
Species Human (GRCh38)
Location 9:82111188-82111210
Sequence TGATGCAATGATACTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055991504_1055991509 15 Left 1055991504 9:82111150-82111172 CCTCCGGATGGAGTGTGGCCCTG No data
Right 1055991509 9:82111188-82111210 TGATGCAATGATACTGATTTTGG No data
1055991507_1055991509 -4 Left 1055991507 9:82111169-82111191 CCTGCTACCATCTTGATTTTGAT No data
Right 1055991509 9:82111188-82111210 TGATGCAATGATACTGATTTTGG No data
1055991499_1055991509 28 Left 1055991499 9:82111137-82111159 CCCCTAGATAGAGCCTCCGGATG No data
Right 1055991509 9:82111188-82111210 TGATGCAATGATACTGATTTTGG No data
1055991502_1055991509 26 Left 1055991502 9:82111139-82111161 CCTAGATAGAGCCTCCGGATGGA No data
Right 1055991509 9:82111188-82111210 TGATGCAATGATACTGATTTTGG No data
1055991505_1055991509 12 Left 1055991505 9:82111153-82111175 CCGGATGGAGTGTGGCCCTGCTA No data
Right 1055991509 9:82111188-82111210 TGATGCAATGATACTGATTTTGG No data
1055991506_1055991509 -3 Left 1055991506 9:82111168-82111190 CCCTGCTACCATCTTGATTTTGA No data
Right 1055991509 9:82111188-82111210 TGATGCAATGATACTGATTTTGG No data
1055991500_1055991509 27 Left 1055991500 9:82111138-82111160 CCCTAGATAGAGCCTCCGGATGG No data
Right 1055991509 9:82111188-82111210 TGATGCAATGATACTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055991509 Original CRISPR TGATGCAATGATACTGATTT TGG Intergenic
No off target data available for this crispr