ID: 1055991510

View in Genome Browser
Species Human (GRCh38)
Location 9:82111196-82111218
Sequence TGATACTGATTTTGGACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 948
Summary {0: 11, 1: 41, 2: 100, 3: 210, 4: 586}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055991508_1055991510 -3 Left 1055991508 9:82111176-82111198 CCATCTTGATTTTGATGCAATGA No data
Right 1055991510 9:82111196-82111218 TGATACTGATTTTGGACTTCTGG 0: 11
1: 41
2: 100
3: 210
4: 586
1055991504_1055991510 23 Left 1055991504 9:82111150-82111172 CCTCCGGATGGAGTGTGGCCCTG No data
Right 1055991510 9:82111196-82111218 TGATACTGATTTTGGACTTCTGG 0: 11
1: 41
2: 100
3: 210
4: 586
1055991505_1055991510 20 Left 1055991505 9:82111153-82111175 CCGGATGGAGTGTGGCCCTGCTA No data
Right 1055991510 9:82111196-82111218 TGATACTGATTTTGGACTTCTGG 0: 11
1: 41
2: 100
3: 210
4: 586
1055991507_1055991510 4 Left 1055991507 9:82111169-82111191 CCTGCTACCATCTTGATTTTGAT No data
Right 1055991510 9:82111196-82111218 TGATACTGATTTTGGACTTCTGG 0: 11
1: 41
2: 100
3: 210
4: 586
1055991506_1055991510 5 Left 1055991506 9:82111168-82111190 CCCTGCTACCATCTTGATTTTGA No data
Right 1055991510 9:82111196-82111218 TGATACTGATTTTGGACTTCTGG 0: 11
1: 41
2: 100
3: 210
4: 586

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055991510 Original CRISPR TGATACTGATTTTGGACTTC TGG Intergenic
900613607 1:3554594-3554616 TCATTCTCACTTTGGACTTCCGG - Intronic
900700339 1:4044479-4044501 TAATACTGATTTTAGGCTTCTGG + Intergenic
900861820 1:5239142-5239164 TGCTCCTGATTTTGGACCTCAGG - Intergenic
901575575 1:10198230-10198252 TGATACTGATTTTGGACATCTGG - Intergenic
901829294 1:11882254-11882276 GGATACTGATTTTAGACTTCTGG + Intergenic
902091302 1:13905886-13905908 AGATACTGATTTTGGATTTCTGG - Intergenic
902147062 1:14410904-14410926 GGACACTGATTGTGGACTTCTGG + Intergenic
902257883 1:15202450-15202472 TGAAACTGAGGCTGGACTTCTGG - Intronic
902574193 1:17366961-17366983 TGAGACTGATTTTGATCTCCTGG - Intergenic
902755074 1:18543677-18543699 TGATCCTGATTTTGAACTTCCGG + Intergenic
903489770 1:23719444-23719466 TGAGACCCATTTTGGACCTCTGG - Intergenic
904792758 1:33036280-33036302 TGATAATGATTTATGACTTAGGG - Intronic
904814369 1:33183853-33183875 TGATGCAGAGTCTGGACTTCAGG + Intergenic
904916270 1:33972726-33972748 TGAGTCTGATTGTGGACTTCTGG + Intronic
905269652 1:36779080-36779102 TGAAGCTGATTTTGGACTTTTGG + Intergenic
905506163 1:38481224-38481246 TGAGCCTGATTTTGAACCTCTGG + Intergenic
905801042 1:40842943-40842965 TGAAACTGATGTTGAACTTCTGG + Intergenic
906566370 1:46804002-46804024 TGATTATGATTCTGGACCTCAGG + Intronic
906605124 1:47163956-47163978 AACTAGTGATTTTGGACTTCAGG - Intergenic
906778363 1:48550252-48550274 TGAAACTGATTTCTGACTTCTGG - Intronic
907567493 1:55449551-55449573 TGATACTGATTTTGGATTTCTGG + Intergenic
907750391 1:57257677-57257699 TGAAACTGATTTAAGACTCCTGG - Intronic
907824511 1:58002085-58002107 TGATACTGATTTTGGACTTTTGG + Intronic
908289904 1:62655000-62655022 TGATACTGATTTCAGACTTTTGG + Intronic
908379864 1:63586800-63586822 TTATACTGATTTTGAAATTCTGG - Intronic
908406721 1:63821483-63821505 TGTTAGTGATTCAGGACTTCTGG + Intronic
908815541 1:68029289-68029311 TGAAACAGAATTTGGATTTCTGG - Intergenic
908825025 1:68124852-68124874 TGAAACTGGTTTTAGACTCCAGG + Intronic
910103966 1:83610586-83610608 TGAAACTGATTTCAGACTTCTGG + Intergenic
910481309 1:87661280-87661302 TGAGACTGATTTTGGACTTCTGG + Intergenic
910502320 1:87907005-87907027 TAATACTGATTTGAGACTTCTGG - Intergenic
910729033 1:90370685-90370707 TTATATTGATTTTGGACTTCTGG + Intergenic
910733782 1:90428893-90428915 TGATACTAATTTCAGAATTCTGG + Intergenic
910784761 1:90984119-90984141 TAATACTGATTTTGAACTTCTGG + Intronic
910802630 1:91161043-91161065 TGAAACTCATCTTGGACTTCGGG - Intergenic
910864942 1:91779841-91779863 CAATGCTGATTTTGGACTTCTGG - Intronic
911593494 1:99774154-99774176 TGATACTGTCTCTGGACTTCTGG + Intergenic
911613150 1:99979193-99979215 TTATATTAATTTTGGATTTCTGG - Intronic
911807732 1:102233322-102233344 TAAAACTGATTTTGGATTTCTGG - Intergenic
912243154 1:107932915-107932937 TGAAACTGATTTTGAACCTTTGG + Intronic
913210824 1:116580935-116580957 ACATCCTGACTTTGGACTTCTGG + Intronic
913293295 1:117295047-117295069 TGGTGCTGATTTCAGACTTCTGG + Intergenic
914254947 1:145954253-145954275 TAATACTGATTTTGGACTTCTGG + Intronic
914334383 1:146701314-146701336 TGAAACTGATTTCAGACTTCCGG - Intergenic
914703906 1:150156131-150156153 TGCTCCTGCTCTTGGACTTCCGG - Exonic
915254414 1:154615141-154615163 TGATACTGATTTCAGATTTCTGG + Intronic
915361078 1:155286758-155286780 TGATACTGCTTTTCTCCTTCAGG + Intronic
915782209 1:158564685-158564707 TGATACTGATTTTGGATTTCTGG + Intergenic
915830926 1:159129260-159129282 TGACCTTGATTTTGGACTTCTGG + Intronic
916358182 1:163936686-163936708 TGAAACTGATTTTGGACTTCTGG - Intergenic
916489642 1:165290259-165290281 TGAAACGGATTTTGAACTTCTGG - Intronic
917066134 1:171095539-171095561 TAATACTGATTTTGCATTTGAGG - Intronic
917500963 1:175584431-175584453 TGATTCTGGACTTGGACTTCTGG + Intronic
917505950 1:175627036-175627058 TCACCTTGATTTTGGACTTCTGG + Intronic
917635245 1:176929513-176929535 AGAAACTGAGTTTGGACTTCTGG + Intronic
918098208 1:181351554-181351576 TGATACTAATTGAGGACATCTGG - Intergenic
918254517 1:182736990-182737012 TGAAATTGATTTCTGACTTCTGG - Intergenic
918489747 1:185068651-185068673 TGATATTGAATTAGGACTTCTGG + Intronic
918523832 1:185443409-185443431 TGATACTGATTTTGGACTTCTGG + Intergenic
918623596 1:186633286-186633308 ACATCTTGATTTTGGACTTCTGG - Intergenic
918707697 1:187688832-187688854 TAATGCTGACTTTGGACTTCTGG - Intergenic
919037992 1:192340992-192341014 TGAGACTGATTTTGGACTTCTGG - Intronic
919192743 1:194244864-194244886 TGATACTGAAGTCAGACTTCCGG + Intergenic
919304014 1:195806801-195806823 TGATACTGACTTCAGACTTGTGG + Intergenic
919396670 1:197058408-197058430 TGAAACTGACTCTGGACTTCTGG - Intronic
919559463 1:199098768-199098790 TGAAAATAATTTTGAACTTCTGG + Intergenic
919719371 1:200815436-200815458 TGAGACTGATATTTGACATCAGG + Intronic
920258873 1:204675359-204675381 GGAGACCCATTTTGGACTTCTGG - Intronic
920789587 1:209076962-209076984 ACACCCTGATTTTGGACTTCAGG + Intergenic
920957081 1:210629575-210629597 TGAGACTGATTTCAAACTTCTGG - Intronic
921583549 1:216923342-216923364 TGATTTTGATTTTGGAGTTTAGG - Intronic
921672579 1:217942476-217942498 ATATACTGAGTTTGGAATTCAGG + Intergenic
923201103 1:231712217-231712239 TAAAACTGATTTCAGACTTCTGG + Intronic
924489482 1:244521424-244521446 TGATACTGAACTTGCACTTCTGG - Intronic
1062808169 10:440727-440749 CAACACTGTTTTTGGACTTCTGG + Intronic
1064512556 10:16111249-16111271 TGAAACTGATTTGGGACTTTTGG + Intergenic
1064884340 10:20092976-20092998 TGATACAGATCTTGGACTTCTGG + Intronic
1064884706 10:20098160-20098182 GGACACTGGTTTTGGACTTCTGG - Intronic
1065468795 10:26054857-26054879 TGAAACTGATTTGGGATTTCTGG + Intronic
1065681183 10:28234304-28234326 GGATACTTATTTTGTACTTTGGG - Intronic
1066104330 10:32143820-32143842 TGTTGCTGATCTTGAACTTCTGG + Intergenic
1066558815 10:36646213-36646235 TCACACTGATTTTGAACTTATGG - Intergenic
1066690941 10:38027558-38027580 TCATGCTGATCTTGGACTCCTGG + Intronic
1066755549 10:38708564-38708586 TGATATTGATATTGGTCATCAGG - Intergenic
1067041819 10:42958108-42958130 TGATGCTGATTGCAGACTTCTGG + Intergenic
1067109341 10:43388767-43388789 TTACTCTGAGTTTGGACTTCAGG - Intronic
1067673018 10:48343163-48343185 TAATACTGAGTTCAGACTTCTGG - Intronic
1069658558 10:70108337-70108359 TAAAACTCATTGTGGACTTCTGG - Intronic
1070090877 10:73284070-73284092 TGAAACTGATTTCAGACTTTTGG - Intronic
1070485409 10:76925784-76925806 TGCTCGTGATTTTGGAGTTCTGG - Intronic
1070591172 10:77802152-77802174 TGGTCCTGAGTGTGGACTTCTGG + Intronic
1071055170 10:81501743-81501765 TGATACTGATTGTTGATATCAGG - Intergenic
1071351058 10:84745600-84745622 TTATATTCATTTTGGACCTCTGG - Intergenic
1072057221 10:91771989-91772011 ACATCTTGATTTTGGACTTCTGG - Intergenic
1072103471 10:92251521-92251543 TGTTACTGTTTTTGGAATTCTGG - Intronic
1072791072 10:98318266-98318288 TGTTACTGATTTTGGACTTGTGG + Intergenic
1073088182 10:100909270-100909292 TGATACTGATTTTCCACTTACGG + Intergenic
1073272651 10:102278861-102278883 TGATACTAATTTTGATCATCTGG + Intronic
1073598592 10:104824115-104824137 TAAAACCCATTTTGGACTTCTGG + Intronic
1073681755 10:105712358-105712380 TGAACCTGATTTCAGACTTCTGG + Intergenic
1073887033 10:108051040-108051062 TGAAACTGATTTTGGATTTCTGG + Intergenic
1074153155 10:110776398-110776420 TGAGGCTGGTTTTGGACTTATGG - Intronic
1074189484 10:111123572-111123594 TGAGAATGGTGTTGGACTTCAGG + Intergenic
1075182828 10:120227407-120227429 TGACACTGATTTTAGACTTCTGG - Intergenic
1075427017 10:122349871-122349893 TGAAACTGATTTTGGACTTCTGG + Intergenic
1075512627 10:123084639-123084661 TGATACTCATTTCAAACTTCTGG + Intergenic
1076377571 10:130001931-130001953 TGATACTGATTTCTGACTTTGGG - Intergenic
1076380586 10:130022369-130022391 CTATTTTGATTTTGGACTTCTGG + Intergenic
1076635323 10:131878643-131878665 TGAAACTGGTTTTGGACTTCTGG - Intergenic
1076651678 10:131993961-131993983 TGAAACTGATGTTGAACTTCTGG - Intergenic
1076808905 10:132876475-132876497 GGACACTGATTTTCGGCTTCCGG + Intronic
1077288127 11:1776593-1776615 CGACACTGAGTCTGGACTTCCGG - Intergenic
1077590232 11:3485362-3485384 TTTGATTGATTTTGGACTTCTGG + Intergenic
1078038458 11:7833794-7833816 TGATACTTATTTTAGACTTCTGG + Intergenic
1078417235 11:11175761-11175783 TGATATTGATTTCAGACTTCTGG + Intergenic
1078472159 11:11598310-11598332 TAAGACTAATTTTGGACTTCTGG - Intronic
1078587566 11:12606721-12606743 TGAAACCGATTTTGGACTTCTGG - Intergenic
1078869777 11:15332662-15332684 TGATACTGTATTTGGAGTTAGGG - Intergenic
1078906302 11:15691263-15691285 TGATACTGATTTCAGACTTCTGG - Intergenic
1079448996 11:20582960-20582982 TGATACTGAGTTTGGACTTCCGG + Intergenic
1079603194 11:22336211-22336233 TATTAATGATTTTGGAATTCTGG - Intergenic
1079881628 11:25935000-25935022 TGATACTGATTTCAGACTTCTGG + Intergenic
1079995990 11:27295662-27295684 AGATACTGAACTTGTACTTCAGG - Intergenic
1080044179 11:27790956-27790978 TGGTACTGAGTTTTGACTTTTGG + Intergenic
1080048613 11:27835890-27835912 TGATATGGATTTTGGATTTCTGG - Intergenic
1080287247 11:30629598-30629620 GGAGACTGATTTCAGACTTCTGG - Intergenic
1080365694 11:31571317-31571339 TGATACGGAGTTGGTACTTCTGG - Intronic
1080391865 11:31855431-31855453 TAAAATTGACTTTGGACTTCTGG + Intronic
1080415714 11:32068168-32068190 TGAAGCTCATGTTGGACTTCTGG + Intronic
1081114766 11:39186709-39186731 TGACACTGATTTTGAACTTCTGG - Intergenic
1081264163 11:40998830-40998852 TTATACTTCTTTTGGATTTCTGG + Intronic
1081391633 11:42536562-42536584 TGGTCCTGATTTTGAATTTCAGG + Intergenic
1081518624 11:43859866-43859888 TAACACTCATTTTGGACTTCTGG + Intergenic
1081754731 11:45536477-45536499 CGACACTGATTTTGGACTTTTGG - Intergenic
1081762930 11:45589773-45589795 TGATACTGATTTTGGATCTCTGG + Intergenic
1081926171 11:46830606-46830628 TAAGACTCATTTTGGATTTCTGG + Intronic
1081955843 11:47091920-47091942 TAAGACTCATTTTGGACTTCTGG + Intronic
1082184002 11:49157405-49157427 TGATACAGATTTTGGATTTTTGG - Intronic
1082221596 11:49645520-49645542 TGAGGCTAATTTTGGATTTCTGG - Intergenic
1082752920 11:57040669-57040691 AGAGACTGATTTTAGACTTAAGG + Intergenic
1082913043 11:58398606-58398628 TGCCACTGATTTGGGACTTCTGG - Intergenic
1082922285 11:58508627-58508649 TGAAACTGATTTGAGGCTTCTGG - Intergenic
1083465623 11:62843809-62843831 TGAGACTCATTTTGGACCTCTGG + Intergenic
1083539521 11:63502766-63502788 ACATATTGATCTTGGACTTCTGG + Intergenic
1083550138 11:63581985-63582007 TGAAACTCATTTTAGACTTCTGG + Intronic
1083708151 11:64530715-64530737 GGAGGCTGATTTTGGACTCCTGG + Intergenic
1084052615 11:66610230-66610252 TGATACTAAGTTTGTACTTCTGG - Intergenic
1084245954 11:67857137-67857159 TTTGATTGATTTTGGACTTCTGG + Intergenic
1084294698 11:68204558-68204580 TGAAACTGATGTTGAACTTCTGG + Intronic
1084788399 11:71457620-71457642 CCATCCTGATTTTGGACTTCCGG - Intronic
1085028360 11:73253795-73253817 TGATACTCACTTTGGGCTTCTGG - Intergenic
1085777151 11:79377234-79377256 TGATACTGATTTTGAACTCCTGG + Intronic
1085919118 11:80930561-80930583 TGAAACTGATTAAGGACTTCTGG + Intergenic
1086154501 11:83650502-83650524 TGAAACTGATTTCAGACTTCTGG + Intronic
1086627439 11:88973638-88973660 TGAGGCTAATTTTGGATTTCTGG + Intronic
1086682353 11:89687964-89687986 TGATACAGATTTTGGATTTTTGG + Intergenic
1086994598 11:93341820-93341842 TGATACTGATTTTGGGCTTCTGG - Intronic
1087240420 11:95768839-95768861 TAAACCTGATTTTGGACTTCTGG + Intergenic
1087910959 11:103752890-103752912 TGATACTCAGTTTGGACTTCTGG + Intergenic
1087952718 11:104243747-104243769 TGAAAGTGATCTTGGACTTCTGG - Intergenic
1088489365 11:110371831-110371853 TGAAACTGAGTTTAGATTTCTGG - Intergenic
1088712633 11:112522280-112522302 TGATACTGGCTTCAGACTTCTGG + Intergenic
1089939066 11:122396613-122396635 TGATACCGATTTCCAACTTCTGG - Intergenic
1089966619 11:122658892-122658914 CGATACTGATTTTCAACTCCTGG - Intronic
1090091775 11:123704268-123704290 TGAAATGGGTTTTGGACTTCTGG + Intergenic
1090467785 11:126950558-126950580 TCATTCTTATTTTTGACTTCAGG + Intronic
1090471618 11:126985942-126985964 AGATACTCATTTTAGGCTTCAGG - Intronic
1091017570 11:132066540-132066562 TGAAGTTGAGTTTGGACTTCTGG - Intronic
1091114781 11:133003242-133003264 TGATGCTGAATTCAGACTTCTGG - Intronic
1091148351 11:133300966-133300988 TGATACTAATTTTGGACTTCTGG + Intronic
1091252329 11:134154332-134154354 TGAGACTGAGGGTGGACTTCAGG - Intronic
1092416532 12:8294265-8294287 TTTGATTGATTTTGGACTTCTGG + Intergenic
1093048242 12:14476567-14476589 TAATACTCATTTTAGACTTGAGG + Intronic
1093376055 12:18429306-18429328 ACACCCTGATTTTGGACTTCTGG + Intronic
1093397991 12:18706873-18706895 TGAAACTGATTTCAAACTTCTGG - Intronic
1093478524 12:19581338-19581360 CGATACTGATTTTAAACTTTGGG + Intronic
1093634116 12:21444016-21444038 TTATACTGAATTAGGTCTTCTGG - Intronic
1093994669 12:25628826-25628848 TGAAACTGATTCTGGGCTTCTGG + Intronic
1094141541 12:27186941-27186963 TGAAACCAATTTTAGACTTCTGG - Intergenic
1094172892 12:27513020-27513042 TGACACTGATGTTGGCCTGCTGG + Intergenic
1094558615 12:31528144-31528166 TAATACTGATTTCTGACTTCTGG - Intronic
1094703288 12:32891207-32891229 TGAGACAAATGTTGGACTTCAGG - Intronic
1095081166 12:38001283-38001305 TGATACTGATTTTTGATGTGTGG + Intergenic
1095158045 12:38882429-38882451 CAATACTGATTTAGGACTTTTGG + Intronic
1095341454 12:41094007-41094029 TGACACTGATTTGGAACCTCTGG - Intergenic
1095399912 12:41802073-41802095 TGAAACTGATTTTTATCTTCTGG + Intergenic
1095746271 12:45662206-45662228 TTAAACTGATTTCAGACTTCTGG + Intergenic
1096732413 12:53625392-53625414 GGATATTGATTTAGGGCTTCTGG - Intronic
1097339158 12:58417717-58417739 TGAAAGTGATTTCAGACTTCTGG + Intergenic
1098664582 12:73146360-73146382 ATATTTTGATTTTGGACTTCTGG - Intergenic
1098875045 12:75858382-75858404 TGATATTGATTTTCAAGTTCAGG + Intergenic
1098909860 12:76198035-76198057 TGATATTTATTTTGGACTTTTGG - Intergenic
1099296758 12:80837593-80837615 TGAAACTGATTTGGGATTTTTGG + Intronic
1099723718 12:86398166-86398188 TGATACTGACTTTAAAGTTCTGG - Intronic
1099804901 12:87506553-87506575 TAATACTGATTTTGGATGTCTGG + Intergenic
1099870541 12:88343682-88343704 TCATACTGGTTTTGAACTCCTGG + Intergenic
1100023293 12:90097392-90097414 TGAAACTGATTTCAGATTTCTGG + Intergenic
1100033962 12:90227978-90228000 TGAAACCCATTTTGGACTTCTGG - Intergenic
1100684338 12:96970326-96970348 TGACACTCATTTTGTATTTCAGG + Intergenic
1100983962 12:100187493-100187515 TGAAGCTGATTTTGAACTTCTGG + Intergenic
1101339571 12:103831028-103831050 TGATAGTGATCTGGGACTCCTGG - Intronic
1101530379 12:105568143-105568165 ACATTTTGATTTTGGACTTCTGG + Intergenic
1101584770 12:106075965-106075987 TGATACTGGTTTTCCACTTAAGG + Intronic
1101749961 12:107575524-107575546 TGAGGCTGATTTTAGACTTCTGG - Intronic
1101850872 12:108401131-108401153 TAAAACTGATTTTGGACTTCTGG + Intergenic
1102054847 12:109888840-109888862 TGATACTAATTTTGGACTTCTGG - Intergenic
1102779993 12:115556041-115556063 TTACCTTGATTTTGGACTTCTGG - Intergenic
1102867268 12:116384194-116384216 ACATTTTGATTTTGGACTTCTGG + Intergenic
1102920290 12:116786755-116786777 TGACACTGATTTTGGATTTCTGG - Intronic
1102922505 12:116802695-116802717 GGAAACTAATTTTGGACTTCTGG + Intronic
1103532633 12:121612957-121612979 ACATCTTGATTTTGGACTTCTGG - Intergenic
1103880061 12:124159153-124159175 TGAGATGCATTTTGGACTTCTGG - Intronic
1103887026 12:124210238-124210260 TGGTACTGATTTTGGACTTTGGG - Intronic
1104059802 12:125257919-125257941 TGTTGCTGATTTTGAACTTCTGG + Intronic
1104179246 12:126362426-126362448 TGATTCTGATTTTCCATTTCTGG - Intergenic
1104381921 12:128314789-128314811 ACACCCTGATTTTGGACTTCTGG + Intronic
1104600927 12:130152800-130152822 ATATATTCATTTTGGACTTCTGG - Intergenic
1105302478 13:19148876-19148898 TGGTACTGACTTTGACCTTCTGG - Intergenic
1105328557 13:19393034-19393056 TGAGGCTGATTTTGAACTCCTGG - Intergenic
1106004359 13:25755155-25755177 TGATACTGTTTTAGGGCATCAGG + Intronic
1106048776 13:26170380-26170402 TTATACTGATCTTGGACTATAGG - Intronic
1106155084 13:27147066-27147088 AGATGCTGATTTTGGACTTCTGG + Intronic
1106245697 13:27948144-27948166 TGATAACAATTTTGGACTTCTGG - Intergenic
1106478545 13:30118793-30118815 TGATACTGATTTTGGAATTCTGG + Intergenic
1106767517 13:32928966-32928988 TGATGTTGATTTTGGACTTCAGG + Intergenic
1106875197 13:34064444-34064466 ACATACTGATTTTGGACCTCAGG - Intergenic
1107631855 13:42350843-42350865 TGAAACCCATTTTGGACTTCTGG + Intergenic
1107636357 13:42396090-42396112 TGATTCTGATTTTTGAGCTCTGG - Intergenic
1107879620 13:44821713-44821735 TGAAACTGACTTAGGATTTCTGG + Intergenic
1107990909 13:45818480-45818502 TGATAATGATTTCAGACTTCTGG - Intronic
1108309419 13:49172448-49172470 AGAAACTCATTTTGGATTTCTGG - Intronic
1108498533 13:51047461-51047483 GCAACCTGATTTTGGACTTCTGG + Intergenic
1108753075 13:53468440-53468462 TGATTTTGACTTTGTACTTCTGG + Intergenic
1109185120 13:59259143-59259165 TGATACTGATTTTGGGCTTCTGG + Intergenic
1109261967 13:60156059-60156081 TGAAACTGATTTGGGACTTCAGG - Intronic
1109601084 13:64629522-64629544 TGAGACCCATTTTGGACTTCTGG - Intergenic
1110299979 13:73914995-73915017 GAAGACTTATTTTGGACTTCAGG - Intronic
1110361482 13:74630327-74630349 TGAAACTGGATTTGGAATTCAGG + Intergenic
1110556442 13:76865158-76865180 TAAAACTGATTTTGGACATCTGG - Intergenic
1111142336 13:84136083-84136105 TGAAACTGATGTTAGACTTCTGG - Intergenic
1111172884 13:84551985-84552007 TGGAACTGATTTGGGACTTCTGG + Intergenic
1111187546 13:84759146-84759168 TGAAACTGATTTCTGAATTCAGG + Intergenic
1111465195 13:88599015-88599037 TGATACTAATTTCAGACTTTTGG + Intergenic
1111467017 13:88626539-88626561 CAAGACTAATTTTGGACTTCTGG + Intergenic
1112207214 13:97336699-97336721 TGAAACCGATTTGGAACTTCTGG + Intronic
1112242857 13:97699315-97699337 TGATACTGATTTTATACATTGGG - Intergenic
1112419010 13:99230523-99230545 TGAGATCCATTTTGGACTTCTGG - Intronic
1113084277 13:106551631-106551653 TGATACTGATTTCAGACTCCTGG - Intronic
1113123782 13:106954071-106954093 TGATAGTAATTTGAGACTTCGGG - Intergenic
1114763785 14:25347947-25347969 TGATACAGGTTTTGGACTTCTGG - Intergenic
1115141173 14:30173005-30173027 TAAGACCCATTTTGGACTTCTGG + Intronic
1115480461 14:33856128-33856150 AGAAACTGATTTTGAACTTCTGG + Intergenic
1115564483 14:34613271-34613293 TGATACTGATTTCTGACTTCTGG + Intronic
1116045433 14:39737156-39737178 TGATACCCATTTTGAACTTCTGG - Intergenic
1116164478 14:41315868-41315890 TCAAACTGATTTCAGACTTCTGG - Intergenic
1116204432 14:41844473-41844495 TTACACTGATTTTGGAGTTGCGG + Intronic
1116746551 14:48826890-48826912 TGATACTAATTTTGGGCTTTTGG + Intergenic
1116807526 14:49508407-49508429 TGATACTAATTTTGGACTTCTGG + Intergenic
1117200719 14:53387188-53387210 TGATTCTGATTTAGGAGGTCGGG + Intergenic
1117420197 14:55537016-55537038 TAATACTGATTTTGGACTTCTGG + Intergenic
1117944164 14:60999877-60999899 TGAAACTGGTTTTGGATTTCTGG + Intronic
1119312644 14:73662521-73662543 TGAAACTGATTTCAGACTTCTGG - Intronic
1120081664 14:80224591-80224613 TGACACTGATTCCAGACTTCTGG + Intronic
1120104149 14:80475176-80475198 TGAAACTGATTTTGGACTTCTGG + Intergenic
1120229904 14:81830418-81830440 TGAGACTCATTTCAGACTTCTGG + Intergenic
1120255784 14:82117667-82117689 CTAAAGTGATTTTGGACTTCTGG + Intergenic
1120303933 14:82743489-82743511 TGATACTCATTTTAGACTTTAGG + Intergenic
1120559043 14:85968729-85968751 TGATACTGATTTTGGACATCTGG - Intergenic
1120574677 14:86167762-86167784 TGATACTGATTTTGGACTTCTGG + Intergenic
1120892556 14:89504224-89504246 TGCTATGGATTTTGGTCTTCTGG - Intronic
1121173983 14:91876759-91876781 TGAAACTGATTTCAGACTCCTGG + Intronic
1121468808 14:94135784-94135806 TGATACTGATTTCAGACTTCCGG + Intergenic
1121476621 14:94213804-94213826 TGATACTGACTTTGAAATTCTGG + Intronic
1121626334 14:95388099-95388121 AGACCTTGATTTTGGACTTCTGG - Intergenic
1121688365 14:95856546-95856568 TGAAAGTGATTTTGGACCTCTGG - Intergenic
1122261864 14:100528206-100528228 TAATATTGATTATGAACTTCGGG - Intronic
1122412475 14:101532833-101532855 TGAAACTGACTTTGGACTTCTGG + Intergenic
1123629202 15:22249317-22249339 TGGAACTCATTTTGAACTTCTGG + Intergenic
1124024251 15:25949967-25949989 TGATACTAATTTTGGACTTCTGG + Intergenic
1125159754 15:36629122-36629144 TGATAAGGGTTTTGGACTTCTGG + Intronic
1125277699 15:38010613-38010635 TGATACTGATTTTGGACATCTGG + Intergenic
1126230056 15:46313811-46313833 TGACACTGATTTTGGGCTGCTGG - Intergenic
1126299615 15:47181689-47181711 TGAAAGTGATTTTGGACTTCTGG - Intergenic
1126808232 15:52374770-52374792 TGATAATGATTTTGGACTTCTGG + Intronic
1127243808 15:57149314-57149336 TGATACTGAATTTGGAGAACTGG + Intronic
1127543989 15:59972508-59972530 TCATACTGATTTCAGACTTCTGG + Intergenic
1128396406 15:67230590-67230612 ACACCCTGATTTTGGACTTCTGG + Intronic
1128879307 15:71228414-71228436 TGATGCTGATTTTAAATTTCTGG + Intronic
1129580342 15:76802371-76802393 TCATGCTGATTTGGGACTTGTGG - Intronic
1129974132 15:79807240-79807262 TGAAACTGATTTCAGATTTCTGG - Intergenic
1130012687 15:80164146-80164168 TGAGACTGATTTTTGACTTCTGG - Intronic
1130385390 15:83406919-83406941 TGAAACTGATCTTGAACTCCTGG - Intergenic
1130405361 15:83595555-83595577 TGATATTGATCTTGGTCTGCTGG + Intronic
1130938120 15:88487310-88487332 TGATACTGATTTGGGACTTCTGG + Intergenic
1130992582 15:88884975-88884997 TGAAACTAATTTTGGATTTCTGG + Intronic
1131348224 15:91671415-91671437 ACATACTGATTTTGAATTTCTGG - Intergenic
1131696689 15:94884098-94884120 TGATACAGATTTTGGACTTCTGG + Intergenic
1131904865 15:97132301-97132323 TGATACTGATTTCAGACTCCTGG - Intergenic
1131916718 15:97274038-97274060 TGGTACTGATTTTGGACTGCTGG - Intergenic
1132334119 15:101033006-101033028 GGAAACTTACTTTGGACTTCTGG - Intronic
1132774135 16:1582467-1582489 TGAAACTGATTTGGGACCTCTGG + Intronic
1133914541 16:10097229-10097251 TGATACTGGTTTTCCATTTCTGG + Intronic
1134087751 16:11370238-11370260 TGATTGTGATTTTGAACTCCTGG + Intronic
1134228494 16:12410867-12410889 TGGTGATGTTTTTGGACTTCAGG + Intronic
1134386544 16:13778917-13778939 GCACATTGATTTTGGACTTCTGG - Intergenic
1135353873 16:21753353-21753375 TGGTACTGATTTTCTACTTATGG + Intronic
1135452362 16:22569492-22569514 TGGTACTGATTTTCTACTTATGG + Intergenic
1136727136 16:32368277-32368299 TGATATTGATATTGGTCATCAGG + Intergenic
1136744751 16:32576090-32576112 TGAAACTGATTTTGGATGTGTGG + Intergenic
1137477786 16:48825444-48825466 GAAAACCGATTTTGGACTTCTGG + Intergenic
1137872854 16:51967218-51967240 TGATGCTGATGTTGCTCTTCTGG + Intergenic
1138123113 16:54416278-54416300 GGATACTAATTTTGGACTTCTGG + Intergenic
1138197154 16:55060102-55060124 TTCAACTGATTTTGGCCTTCTGG + Intergenic
1138310288 16:56017734-56017756 TGACCTTGATATTGGACTTCTGG + Intergenic
1138478818 16:57288103-57288125 TGAAACTGATTTCAGACTTCTGG - Intergenic
1138624733 16:58241703-58241725 TGAGACCCATTTTGGACTTCTGG - Intronic
1139043663 16:63030998-63031020 TGATAGTTATTTCAGACTTCTGG - Intergenic
1139254763 16:65530332-65530354 ACACACTGATTTTGGATTTCTGG - Intergenic
1139999234 16:71009918-71009940 TGAAACTGATTTCAGACTTCCGG + Intronic
1140330856 16:74055517-74055539 TGAGACTGATTTCAGACTTTTGG - Intergenic
1141311845 16:82921213-82921235 TGATGCCGATTTTGGACTTCTGG - Intronic
1141326403 16:83063729-83063751 TGAAACTCATTTTGAACTTTTGG - Intronic
1141376056 16:83531800-83531822 TGAAATGGATTTTGGACTCCTGG + Intronic
1141471957 16:84244811-84244833 TAAGACTCATTTTAGACTTCTGG + Intergenic
1141923535 16:87152530-87152552 TGAGGCTCGTTTTGGACTTCTGG - Intronic
1141974852 16:87508933-87508955 TGGAACTCATTTTGAACTTCTGG - Intergenic
1202999298 16_KI270728v1_random:149471-149493 TGATATTGATATTGGTCATCAGG - Intergenic
1203024846 16_KI270728v1_random:499138-499160 TGAAACTGATTTTGGATGTGTGG - Intergenic
1203046875 16_KI270728v1_random:835293-835315 TGAAACTGATTTTGGATGTGTGG + Intergenic
1203130896 16_KI270728v1_random:1685881-1685903 TGATATTGATATTGGTCATCAGG - Intergenic
1143020409 17:3914619-3914641 TGATACTAAGGGTGGACTTCCGG + Intronic
1143108129 17:4539569-4539591 TGATGCTGCTTTTGGCCTGCAGG + Exonic
1143748415 17:9010707-9010729 TGATACCAATTTCAGACTTCTGG - Intergenic
1143907737 17:10222996-10223018 TGAAACTGATTTTAAAGTTCTGG - Intergenic
1144028473 17:11299521-11299543 TGAAAGCTATTTTGGACTTCTGG - Intronic
1145375844 17:22347457-22347479 AGATACAGATGATGGACTTCAGG + Intergenic
1145889204 17:28403163-28403185 TGGTACTGACTTTGGACTTCTGG + Exonic
1146012864 17:29209526-29209548 TAATACTGATTTGGGACTAGGGG - Intergenic
1146103461 17:30008873-30008895 TGATACTGATCTTGGACTTCTGG - Intronic
1146178610 17:30683002-30683024 TGATACTGATTTGGGACTTAAGG - Intergenic
1146503932 17:33388304-33388326 TAATACGTATTTTGGACTTTTGG + Intronic
1147035715 17:37678849-37678871 TGATACTGATTTTGGACTTCTGG + Intergenic
1148220135 17:45855321-45855343 TGATCCTGATTCCAGACTTCTGG + Intergenic
1148573937 17:48694728-48694750 TGATGCTGATTTTGAACTTCTGG - Intergenic
1148717465 17:49726058-49726080 TGAAACAGAACTTGGACTTCTGG + Intronic
1149053221 17:52331662-52331684 TGACACTGGATTTGGACTACAGG + Intergenic
1149246274 17:54712123-54712145 TGATACTGATTTCAGACTTCTGG - Intergenic
1149469905 17:56908015-56908037 ACATCTTGATTTTGGACTTCTGG + Intronic
1150050241 17:61954947-61954969 CGAAACTGATTTCAGACTTCTGG - Intronic
1150097663 17:62392463-62392485 TGTTACTGCTTTTGTACATCAGG - Intronic
1150331023 17:64294350-64294372 TGATGCTGATTTTGGACTGCTGG + Intergenic
1150805210 17:68313319-68313341 TAACCTTGATTTTGGACTTCTGG - Intronic
1150943290 17:69716913-69716935 TGATTGTGCTTTTGGATTTCAGG + Intergenic
1150962653 17:69931592-69931614 TGTTACTGTTTTTAAACTTCTGG - Intergenic
1151086014 17:71381591-71381613 TGATCCAGATATTGGACATCTGG - Intergenic
1151251554 17:72839596-72839618 TGAAACTGATGTCAGACTTCTGG + Intronic
1151271817 17:73002752-73002774 TGATACTGATTTTGCATTTCTGG - Intronic
1151382819 17:73737278-73737300 TGAGACTTATTTTGGACCTTTGG - Intergenic
1152753958 17:82079190-82079212 TGATGCTGATGATGGACTCCAGG + Exonic
1152854259 17:82655208-82655230 AGTTATTGGTTTTGGACTTCCGG - Exonic
1153142476 18:1989608-1989630 TGATACTGATTTTAGATTTCTGG - Intergenic
1153145893 18:2032258-2032280 TGATATTGATTTTGGACTCTTGG - Intergenic
1153175743 18:2371061-2371083 GACAACTGATTTTGGACTTCTGG + Intergenic
1153433138 18:5040339-5040361 AGATTCTGATTCAGGACTTCTGG - Intergenic
1155049743 18:22136238-22136260 TGTTACTGAATTTGGATTTATGG + Intergenic
1155380085 18:25211277-25211299 TGATACTGATTATATACTTAGGG + Intronic
1156142452 18:34132005-34132027 ACATTTTGATTTTGGACTTCTGG - Intronic
1156172651 18:34505082-34505104 TGAAACTGATTTTTGAGTTCTGG - Intronic
1156695569 18:39762102-39762124 AGAAACTGGATTTGGACTTCTGG - Intergenic
1156697328 18:39782764-39782786 TCAGACTGATCTTGAACTTCCGG - Intergenic
1157056530 18:44235511-44235533 TGAAACTGATTTTGTACTTCTGG - Intergenic
1157392078 18:47311332-47311354 CGAAACTGATTTCAGACTTCTGG - Intergenic
1158030986 18:52964781-52964803 TGAAACTGATTTCCAACTTCTGG - Intronic
1158301239 18:56055542-56055564 TGAAACTGATCTTGGATGTCTGG + Intergenic
1158965446 18:62618533-62618555 TGATGCTGATGTTGTAATTCGGG + Intergenic
1159105461 18:63998708-63998730 TCCCACTGATTTTGGTCTTCAGG - Intronic
1159438198 18:68445286-68445308 TGATACTGATTTCAGACTTCTGG - Intergenic
1159703954 18:71663670-71663692 TGAGACTGATTTTGGGCTTCTGG + Intergenic
1160106562 18:75983486-75983508 TGACACTGATTTAGAACCTCTGG + Intergenic
1160420697 18:78742030-78742052 TGAAGCTGACTTTGGGCTTCTGG - Intergenic
1160593007 18:79954368-79954390 TAAAAGTGATTTTGGACTTTTGG + Intergenic
1161116125 19:2497496-2497518 GGAGACTGATTTTGGATTCCTGG - Intergenic
1161835216 19:6641363-6641385 TGAAACTGATTTTGGAGTCTGGG - Intergenic
1161836573 19:6651383-6651405 TAAGACTCATTTTGGACTTCTGG + Intergenic
1162688432 19:12407945-12407967 TGATGCTGGTCTTGAACTTCTGG - Intronic
1162980005 19:14232570-14232592 TGATACTGATTTGGGACTTAAGG + Intergenic
1163486195 19:17587959-17587981 TGAAACTGATTTCAGAATTCTGG - Intergenic
1164568043 19:29343520-29343542 ATATAATGATTTTGGACCTCTGG + Intergenic
1165747183 19:38236814-38236836 TGACACTGACTTTGGACTTCTGG - Intergenic
1165999843 19:39871415-39871437 TGATCCTGATTTCTGACTTCTGG - Intronic
1166145101 19:40828771-40828793 TGAAGCTGATTTTGGAATTCTGG - Intronic
1167085546 19:47307288-47307310 ACATCTTGATTTTGGACTTCTGG + Intronic
1167489649 19:49784666-49784688 TGTTGCTGATCTTGAACTTCCGG - Intronic
1167746856 19:51356761-51356783 TGACACTGACTTTGGACTTCTGG - Exonic
1168673526 19:58259492-58259514 TGACATTGATTTTGGACTTGTGG - Intronic
1168695056 19:58399522-58399544 TGAAACTGATCGTTGACTTCTGG - Intergenic
926028268 2:9563635-9563657 ACACCCTGATTTTGGACTTCTGG + Intergenic
926512823 2:13803534-13803556 ACACCCTGATTTTGGACTTCTGG + Intergenic
926741969 2:16119150-16119172 TGATAGTGATTTTGGATTATAGG + Intergenic
926942345 2:18151742-18151764 ACAACCTGATTTTGGACTTCTGG + Intronic
928138041 2:28703447-28703469 TGATACTGACTTTGGACTTCAGG - Intergenic
928138482 2:28707006-28707028 TGATACTGATTTTGAACTTCTGG + Intergenic
928342295 2:30455402-30455424 TGATAATGATTTCAGAATTCTGG - Intronic
928689508 2:33784562-33784584 ACACTCTGATTTTGGACTTCCGG + Intergenic
928945198 2:36765814-36765836 TGATGCTGATGTCTGACTTCTGG + Intronic
928977173 2:37100317-37100339 TGAATCTCATTTTAGACTTCTGG + Exonic
929029540 2:37637626-37637648 TGACACCGATTTCAGACTTCTGG - Intergenic
929153577 2:38769881-38769903 TGACACAGATCTTAGACTTCAGG + Intronic
929488955 2:42379588-42379610 TGCGACTGATTTGGGACTTCTGG - Intronic
929571473 2:43025753-43025775 AGATGCTGATTTTGCCCTTCTGG - Intergenic
929572839 2:43033495-43033517 CGAGACTGATTTTGGGCTTCTGG + Intergenic
929623430 2:43381260-43381282 AGATATTTATTTTGTACTTCGGG - Intronic
930477525 2:51902278-51902300 AGTTACTGATTTTGAACTTTTGG + Intergenic
930537106 2:52656772-52656794 TGATACTGATTTTGGACTTCTGG - Intergenic
930779794 2:55213203-55213225 TGATACTGATTTTGAATTTCTGG - Intronic
930974375 2:57437632-57437654 TGCAACTCATTTTGGACTTCTGG + Intergenic
930977400 2:57480085-57480107 GGATACCTATCTTGGACTTCTGG + Intergenic
931214572 2:60228932-60228954 TGATACTCACTTCAGACTTCTGG + Intergenic
931685366 2:64787681-64787703 TGACACAGATTTTGGACTTCTGG + Intergenic
931792067 2:65672496-65672518 TCATAGTGATTGTGGACTTTTGG + Intergenic
931940435 2:67246074-67246096 ACATGTTGATTTTGGACTTCTGG + Intergenic
931948803 2:67338064-67338086 TAAGACTCATCTTGGACTTCTGG - Intergenic
931961527 2:67488263-67488285 TCATACTGACTTAGGATTTCTGG + Intergenic
932145539 2:69312881-69312903 TCATACTGACTTCGGACTTCTGG - Intergenic
932206660 2:69889402-69889424 TAAAACTGGTTTTGGACTTCTGG - Intergenic
932376235 2:71238460-71238482 TGATTCTGATATTTGCCTTCTGG - Intergenic
932425760 2:71633967-71633989 TCATACTGATTTGGGTCTTCAGG + Intronic
932484097 2:72070836-72070858 TGAACCTGTTTTTGGACCTCTGG + Intergenic
932885656 2:75547009-75547031 ACATCCTGATTTTGGCCTTCTGG + Intronic
932900842 2:75697935-75697957 ACATTATGATTTTGGACTTCTGG + Intronic
934165375 2:89289588-89289610 AGATACTGATTCTAGATTTCTGG - Intergenic
934201899 2:89892874-89892896 AGATACTGATTCTAGATTTCTGG + Intergenic
934318850 2:91952802-91952824 TGATATTGATATTGGTCATCAGG - Intergenic
934509471 2:94925725-94925747 ATAGACTTATTTTGGACTTCTGG - Intergenic
934790630 2:97056839-97056861 TGAAACTGATGCTGGACTTTTGG + Intergenic
934815830 2:97325690-97325712 TGAAACTGATGCTGGACTTCTGG - Intergenic
934821865 2:97382793-97382815 TGAAACTGATGCTGGACTTCTGG + Intergenic
935519449 2:104085682-104085704 TGATACTTATTTCAGACTTCTGG + Intergenic
936393215 2:112095233-112095255 TGATTCTGATCTTGTTCTTCTGG + Intronic
937330491 2:121024322-121024344 TGAAGCTGATTTTGGACTTCTGG + Intergenic
937667870 2:124507247-124507269 TCAGGCTGATTTTGAACTTCTGG - Intronic
938100676 2:128496058-128496080 TGACACTGATTTTCACCTTCGGG - Intergenic
938556806 2:132431893-132431915 AGAAACTTATTTTGGACTTCTGG - Intronic
938792866 2:134692239-134692261 CGATCCTGATTTTGGACTTCTGG + Intronic
938946532 2:136217374-136217396 TGATACTGATTTGGTAACTCAGG + Intergenic
939038503 2:137161098-137161120 TGATATTGATCTTGGGCTTAAGG + Intronic
939057741 2:137383866-137383888 TAAAACTGATTTTGAATTTCTGG + Intronic
939585024 2:143993684-143993706 GGATACTGAATTCTGACTTCTGG + Intronic
939600837 2:144188089-144188111 TGGCCCTGATATTGGACTTCTGG + Intronic
939928937 2:148207993-148208015 TGATACTGATTTCAGACTCCTGG - Intronic
939986600 2:148834972-148834994 GCACCCTGATTTTGGACTTCGGG - Intergenic
940442202 2:153729794-153729816 TGCTACTGATTTTTGAATACTGG - Intergenic
940495223 2:154418624-154418646 TAAAACTGATTTTGGACTTCTGG + Intronic
940649533 2:156427772-156427794 TGATGTTGATTTTCAACTTCTGG - Intergenic
941298007 2:163764554-163764576 TGACATTGATTTGGGACTTATGG - Intergenic
941958662 2:171231155-171231177 ACATCTTGATTTTGGACTTCTGG - Intronic
942113286 2:172703296-172703318 TGATACTGATTTTGGACCTCTGG + Intergenic
943132243 2:183868493-183868515 TAAAATTGATTTTGAACTTCTGG + Intergenic
943286369 2:186006564-186006586 TGAAACTGATTTTGGATTTGTGG + Intergenic
944343033 2:198625627-198625649 TGAAGCTGATTTTGGTCTTTGGG - Intergenic
944840650 2:203620667-203620689 TGAAATTGATTTTGGACTTCTGG + Intergenic
944876865 2:203971368-203971390 TGGAACTAATTTTAGACTTCTGG - Intergenic
945571488 2:211473347-211473369 TGATTCTGATTTTAGGTTTCTGG + Intronic
945757898 2:213872283-213872305 TGAAACTTATTTTGTACTTATGG + Intronic
945892782 2:215447838-215447860 ACATCTTGATTTTGGACTTCTGG + Intergenic
946088343 2:217196971-217196993 TGAAGCTGACTGTGGACTTCTGG - Intergenic
946725479 2:222657269-222657291 TGAAACTGATTTTGGGTTTCTGG + Intergenic
946889019 2:224255135-224255157 TGTTATGGATTTTGGACTTTAGG - Intergenic
947985467 2:234444001-234444023 TGAAACTGATTTTGGATATTTGG + Intergenic
948120740 2:235528415-235528437 GGATATTGATTATGGACTTTTGG + Intronic
948223205 2:236289688-236289710 TGATTCTGATTGTTGACTTGTGG - Intergenic
948263077 2:236618565-236618587 TGAAACTGATTTCAGACTTCCGG - Intergenic
948342103 2:237261844-237261866 TGATATTTATTTTGCACTTTGGG - Intergenic
948442611 2:238005022-238005044 TGAGACCCATTTTGGTCTTCTGG + Intronic
1168906405 20:1407443-1407465 TGATACTGATTTCAGACTTCTGG + Intergenic
1168950135 20:1792336-1792358 TGATTCTAATTTTGGATTTCTGG - Intergenic
1169947617 20:11006270-11006292 AGAAGCTGATTTTGGACTTCTGG - Intergenic
1170198017 20:13710906-13710928 TGATGCTCATTTTGGGCTACTGG - Intergenic
1170608170 20:17889402-17889424 TGGCACTGATTTCAGACTTCTGG - Intergenic
1171131942 20:22662075-22662097 TGATACAGATGTTGCACATCTGG + Intergenic
1171148619 20:22807435-22807457 TGAAACTGATTTTGGACTTCTGG - Intergenic
1172863320 20:38074371-38074393 TGATACTTATTTTTCACTCCAGG + Intronic
1173155699 20:40606778-40606800 TGAAACTCGTTTTGGATTTCTGG - Intergenic
1173394563 20:42667189-42667211 TGATAATGATTCTGGATTTCAGG + Intronic
1173540156 20:43844969-43844991 TGATAATGACTTCAGACTTCTGG + Intergenic
1173554077 20:43953190-43953212 TGAGGCTGATTTTAGACTTCGGG + Intronic
1173561721 20:44010882-44010904 GGAGACTGCTTCTGGACTTCTGG - Intronic
1173624809 20:44464989-44465011 TGAAAATGATTTTGGGCATCAGG - Intronic
1174731068 20:52918251-52918273 ACATCTTGATTTTGGACTTCTGG - Intergenic
1174911817 20:54615983-54616005 AGAAACTGATTTGGGACTTCTGG + Intronic
1175029316 20:55936623-55936645 TGATACTGTTTTTTCACTTACGG - Intergenic
1175119904 20:56709500-56709522 TGATACTGACTTCAGGCTTCTGG - Intergenic
1175648804 20:60698772-60698794 TGATACTGACTCAGAACTTCCGG + Intergenic
1175793003 20:61754169-61754191 ACATCTTGATTTTGGACTTCTGG + Intronic
1176701116 21:10051419-10051441 TGATACTGATTATGAATTTTTGG - Intergenic
1176893873 21:14352171-14352193 ATATATTGATTTTAGACTTCTGG - Intergenic
1176900945 21:14441225-14441247 TTATTCTTATTTTGGACTACAGG - Intergenic
1176943188 21:14948696-14948718 TGTAACTGATTTTGGACTTCTGG - Intergenic
1177813446 21:25949837-25949859 GAACACAGATTTTGGACTTCTGG + Intronic
1178094962 21:29204842-29204864 TGATACTGATGCTGCAGTTCTGG - Intronic
1178133422 21:29599503-29599525 TAACACTGATTTTGGATTTCAGG - Intronic
1178183050 21:30186469-30186491 TAAAACTCATTTTGGACTTCCGG + Intergenic
1178223056 21:30683235-30683257 TTATACTGATTTCAGACTTCTGG - Intergenic
1178307222 21:31500812-31500834 ACATCTTGATTTTGGACTTCTGG + Intronic
1178309530 21:31518219-31518241 TGGAACTCATTTGGGACTTCTGG + Intronic
1178320397 21:31600755-31600777 GGATCTTGATGTTGGACTTCTGG + Intergenic
1178991877 21:37363719-37363741 ACATCTTGATTTTGGACTTCTGG - Intergenic
1179016664 21:37599969-37599991 TAGTACTGATTTCAGACTTCTGG - Intergenic
1179031966 21:37728820-37728842 AACTACTGATTTTGAACTTCTGG - Intronic
1179164829 21:38927238-38927260 GGAAACTGGTTTTGGACTTCTGG - Intergenic
1179268913 21:39832931-39832953 TGACACTCATTTCAGACTTCTGG + Intergenic
1179469138 21:41598815-41598837 TGAAACTGACTGTGGACGTCTGG + Intergenic
1179646858 21:42781587-42781609 TGGTACTGATTGAGAACTTCTGG - Intergenic
1180307023 22:11136463-11136485 TGATATTGATATTGGTCATCAGG - Intergenic
1180545543 22:16498646-16498668 TGATATTGATATTGGTCATCAGG - Intergenic
1181101661 22:20544711-20544733 TGGTACTGACTTTGAACATCTGG - Intronic
1181682035 22:24501959-24501981 TCATGCAGATTTTGGACATCAGG + Intronic
1181769900 22:25117828-25117850 ACATTTTGATTTTGGACTTCTGG - Intronic
1182409070 22:30167019-30167041 TCATATTGCTTTTGGACTTCTGG - Intronic
1183245323 22:36688840-36688862 GGATACTGATTTGGGGCTCCAGG - Intronic
1184009448 22:41736005-41736027 TGATACTGATTTTGGACTTCTGG - Intronic
1184107103 22:42374260-42374282 TGAAACTGATTCTGAATTTCCGG - Intergenic
1184382171 22:44151804-44151826 CCATCTTGATTTTGGACTTCAGG - Intronic
949096621 3:94111-94133 TGATACTGATTTTGCTGGTCTGG - Intergenic
949369837 3:3322635-3322657 TGAAGCTGATTTCGTACTTCTGG + Intergenic
949719130 3:6968106-6968128 GCACACTGATTTTGAACTTCTGG - Intronic
949948951 3:9213302-9213324 TGATGCAGGTTTTGGACTGCAGG - Intronic
950884047 3:16347372-16347394 TGATACTGATTTTGAACTTCTGG - Intronic
951066695 3:18275256-18275278 ACACCCTGATTTTGGACTTCTGG + Intronic
951172789 3:19561720-19561742 TGATACTGATTTTGGACTTTTGG + Intergenic
951534852 3:23731226-23731248 TCATCTTGATCTTGGACTTCCGG - Intergenic
951877137 3:27440157-27440179 TAAGACTCATTTTGGACTTCTGG - Intronic
952126205 3:30304010-30304032 TAATGCTGATTTTGGACTTATGG - Intergenic
952290149 3:32007418-32007440 TGATACTGATTTCAGACTTCTGG - Intronic
952336552 3:32408194-32408216 TGATAGCGATTTCAGACTTCTGG + Intronic
952632588 3:35487495-35487517 TGATGCTGATTTTGAACTTCTGG - Intergenic
953453499 3:43023351-43023373 TGAAACTGATGTGGAACTTCTGG + Intronic
954881871 3:53841935-53841957 TGAGGCTGATATTGAACTTCTGG - Intronic
955101020 3:55849967-55849989 ACATCTTGATTTTGGACTTCTGG - Intronic
955264443 3:57427854-57427876 ACATCCTGATTTTGGACTTCTGG + Intronic
955319942 3:57967194-57967216 ACATCTTGATTTTGGACTTCTGG - Intergenic
955322527 3:57984541-57984563 TGAAACTGATTGCTGACTTCTGG + Intergenic
955572072 3:60318805-60318827 TGAAACTGATTTTGTACTTCTGG - Intronic
955844141 3:63143026-63143048 ACATACTGATTTTAAACTTCTGG - Intergenic
956381008 3:68664373-68664395 TGATACTGAGTGAGGAATTCAGG + Intergenic
956984711 3:74685323-74685345 TGAGACACATTTTGGACTTCTGG + Intergenic
957060282 3:75475866-75475888 TTTGATTGATTTTGGACTTCTGG + Intergenic
958186000 3:90119941-90119963 TGAGACTGATTTTGGTCTTCTGG - Intergenic
958600056 3:96285856-96285878 TTCAGCTGATTTTGGACTTCTGG - Intergenic
958607665 3:96379483-96379505 TGATACTGATTTCATACTTCAGG + Intergenic
958736138 3:98011330-98011352 TGATACTGATTTCAGAGTTCTGG - Intronic
959096175 3:101958554-101958576 TGAAACTGATTTTAGAGTTCTGG + Intergenic
959149939 3:102596330-102596352 TGAAACTGATTTAGGACTTTTGG - Intergenic
959462925 3:106649282-106649304 TTATGCTGACTTGGGACTTCGGG - Intergenic
959630403 3:108500999-108501021 TGGATTTGATTTTGGACTTCTGG + Intronic
960023414 3:112981519-112981541 TGCTACTGTTTATGGACTCCTGG - Intergenic
960074702 3:113471523-113471545 TGAAACTGATTTTGGATTTCTGG + Intronic
960170984 3:114460642-114460664 TGAAACTGATTTGAGACTTCTGG + Intronic
960196638 3:114776557-114776579 TGATACCGATTTTGGACTTTTGG + Intronic
960237094 3:115296099-115296121 TAAAACTTATTTTGGACTTCTGG + Intergenic
960705470 3:120476895-120476917 TGATACGGATTGCAGACTTCTGG - Intergenic
960934215 3:122887135-122887157 TGACACTGAGGTTGGTCTTCTGG - Intergenic
961293108 3:125863545-125863567 TTTGATTGATTTTGGACTTCTGG - Intergenic
961611364 3:128142569-128142591 TGAGACCCATTTTGGACTTCTGG - Intronic
961894077 3:130152866-130152888 TTTGATTGATTTTGGACTTCTGG + Intergenic
962261819 3:133915271-133915293 TGATACTAATTTCGGATTTCTGG - Intergenic
962348750 3:134641595-134641617 TGAAACAGATTTTGGACTTCTGG + Intronic
962389945 3:134962849-134962871 TGAGACTGATTTGGGGCTGCTGG - Intronic
962747301 3:138406488-138406510 TGATACTGAGTTTTGATTTCTGG - Intergenic
962888216 3:139647782-139647804 GGATACTGATTTCGAACTTTTGG + Intronic
963080552 3:141389397-141389419 TCATACTGATTTTGTTCTCCAGG + Intronic
963578020 3:147087209-147087231 TGATATTGAATCTGGATTTCAGG - Intergenic
963675033 3:148299958-148299980 TGATACTGATTTTTGTATGCTGG + Intergenic
963709304 3:148728070-148728092 TTAGACTGATTTTGTACTCCAGG - Intronic
964526598 3:157621456-157621478 ACATCTTGATTTTGGACTTCTGG + Intronic
964526961 3:157625222-157625244 ACATCTTGATTTTGGACTTCTGG + Intronic
964542262 3:157792621-157792643 TGGCCCTGATTTTGGATTTCTGG - Intergenic
964560600 3:157991491-157991513 ACATATTGGTTTTGGACTTCTGG + Intergenic
964769221 3:160207011-160207033 TGCTACTGACTTTAGACTTCTGG + Intergenic
964972334 3:162577666-162577688 TGATCCTGGTTGGGGACTTCTGG - Intergenic
965177903 3:165359807-165359829 TGATAGAGATTTTAGAATTCAGG + Intergenic
965305901 3:167062662-167062684 GTACATTGATTTTGGACTTCTGG - Intergenic
965409397 3:168311104-168311126 TGATACTGAGTTTGGAGTAGAGG + Intergenic
965627794 3:170699251-170699273 TGAGACTTACTTAGGACTTCTGG - Intronic
966268089 3:178070955-178070977 TGATACTGACTTCGGACTTCTGG - Intergenic
967122146 3:186391662-186391684 TAATACTGATTTTGGACTTCTGG + Intergenic
967924814 3:194637853-194637875 TGAAACTGATTTCTAACTTCTGG - Intergenic
968037747 3:195562365-195562387 TGATACTGATTTTGGACTTCTGG + Intergenic
968751265 4:2390295-2390317 ACATCCTGATTGTGGACTTCGGG + Intronic
968790092 4:2653934-2653956 ACATACTGATTCTGAACTTCTGG - Intronic
968949220 4:3681824-3681846 TGAGGCTGATTTTGGTGTTCTGG - Intergenic
969004173 4:4005942-4005964 TTTGATTGATTTTGGACTTCTGG + Intergenic
969158054 4:5230596-5230618 TGAAAATCATTTTGAACTTCTGG + Intronic
969280201 4:6165858-6165880 TGATAAGGAATTTTGACTTCTGG - Intronic
969295164 4:6265661-6265683 TGACACTGATTTCAGACTTCCGG - Intergenic
969450431 4:7269756-7269778 TGATACTGATTTGGGACCTCTGG + Intronic
969748689 4:9094203-9094225 TTTGATTGATTTTGGACTTCTGG - Intergenic
969809733 4:9638771-9638793 TTTGATTGATTTTGGACTTCTGG - Intergenic
969938325 4:10705413-10705435 TGAGACTCATTTTGGAATTCTGG - Intergenic
970418521 4:15882845-15882867 TGAAGCTAATTTTGGACTTGTGG + Intergenic
970481471 4:16480103-16480125 ATATCTTGATTTTGGACTTCTGG - Intergenic
970770237 4:19603765-19603787 TGATAATGATTTTGGATTTCAGG - Intergenic
971532064 4:27701404-27701426 TGAGACTCATTTTTGACTTCTGG + Intergenic
971758216 4:30729699-30729721 TGATAATTACTTTTGACTTCTGG + Intronic
972279281 4:37586969-37586991 TGATACCAATTTCAGACTTCTGG - Intronic
972387043 4:38577265-38577287 ACACATTGATTTTGGACTTCTGG + Intergenic
973087333 4:46081923-46081945 TGACATAGATCTTGGACTTCTGG + Intronic
973092149 4:46150083-46150105 TGATATGGATTTTATACTTCTGG - Intergenic
973620032 4:52717049-52717071 TGAAACTGATTTCTGACTTCTGG + Intergenic
974049818 4:56930327-56930349 TGTTACTGATTTTCGAGTTCTGG - Exonic
974165509 4:58196079-58196101 TGAAACTTATTTAGGACTTCTGG + Intergenic
974207602 4:58726493-58726515 TGCTTCTGATTTTTTACTTCTGG - Intergenic
974232102 4:59130209-59130231 TGCTACTGATTTAGGACTTTTGG - Intergenic
974267953 4:59609940-59609962 TGGTACTGATATCAGACTTCTGG + Intergenic
975262134 4:72315597-72315619 TGAAATTGATTTTTGACTTCTGG + Intronic
975351632 4:73353540-73353562 ACATGTTGATTTTGGACTTCTGG + Intergenic
975401317 4:73942960-73942982 TGAAACTGATTTTTGTCTCCTGG + Intergenic
975466444 4:74714417-74714439 CAAAATTGATTTTGGACTTCTGG + Intergenic
975632770 4:76419465-76419487 TGAGACTGATTTTGGATTCCTGG - Intronic
975890625 4:79022857-79022879 TGACACTGATTTTTGAGGTCTGG - Intergenic
976082298 4:81368980-81369002 TGAGACTGGTCTTGAACTTCTGG - Intergenic
976362869 4:84200982-84201004 TGGTACTGATTTTGGACTTCTGG - Intergenic
976796427 4:88939153-88939175 TGATACTGATTTTGTTCTTTTGG - Intronic
976798003 4:88956650-88956672 TGAGACCTACTTTGGACTTCTGG - Intronic
977405639 4:96594873-96594895 AGACACTGATTTGGGAATTCTGG - Intergenic
977642762 4:99375892-99375914 TGATACTGATTTCAGACTTCTGG - Intergenic
977878994 4:102182825-102182847 TGAAACTGATTTCAGACTTCTGG + Intergenic
978232803 4:106421209-106421231 TCAGACTCATTTTGGACATCTGG + Intergenic
978480521 4:109184942-109184964 TGATCCTGATTCTGGCCTCCAGG + Intronic
978604958 4:110469498-110469520 TGATATTCATTTTGGACTTCTGG - Intronic
978872004 4:113590065-113590087 TCCTACTCATTTTGGGCTTCAGG + Intronic
979086885 4:116424259-116424281 GAAAAGTGATTTTGGACTTCTGG - Intergenic
979275896 4:118813734-118813756 ACATATTGATTTTGGACTTTTGG + Intronic
980373267 4:131907742-131907764 GGATACTGATTATGAATTTCTGG - Intergenic
980424313 4:132606918-132606940 TGATACTGATTTCATACTTATGG - Intergenic
980676427 4:136089465-136089487 TAATACTGGTTTTGGGCTCCTGG + Intergenic
981101892 4:140838314-140838336 TGATACTGATATAGGTCTTCTGG - Intergenic
981826975 4:148954455-148954477 TAACCCTGATTTTGGACTTCTGG - Intergenic
981951028 4:150407243-150407265 TGATACTGATTTCAGATTTCTGG + Intronic
981980185 4:150782390-150782412 TAAAACTGATTTCAGACTTCTGG - Intronic
982247312 4:153365987-153366009 TAACACTGATTTTTAACTTCTGG - Intronic
982449059 4:155530848-155530870 AGATAATAATTTTGGACTTAAGG - Intergenic
982897257 4:160947898-160947920 CGATACTGATTTCAGACTTCTGG + Intergenic
982942330 4:161573895-161573917 TGAAACTGATTTTGGTCTTCTGG - Intronic
983164765 4:164461423-164461445 TGCTTCTAATTTTGGACTACAGG - Intergenic
983258414 4:165428604-165428626 TGATACTAATTTCAAACTTCCGG - Intronic
983751868 4:171283948-171283970 TCATATTGATCTTGGAGTTCAGG + Intergenic
984463831 4:180071884-180071906 GCATCTTGATTTTGGACTTCTGG - Intergenic
984834550 4:184007678-184007700 AGATTGTGATTCTGGACTTCTGG - Intronic
984876416 4:184371763-184371785 CCAGACTGATTTTGAACTTCTGG - Intergenic
984882893 4:184425936-184425958 AGACCTTGATTTTGGACTTCTGG - Intronic
985289832 4:188376296-188376318 TGATACTGACTGCAGACTTCTGG - Intergenic
986123343 5:4863485-4863507 CCATCTTGATTTTGGACTTCTGG + Intergenic
986422900 5:7601908-7601930 ACACCCTGATTTTGGACTTCTGG - Intronic
987039278 5:14046570-14046592 TGAAATTGATTTTGGACTGTAGG - Intergenic
987505862 5:18771148-18771170 TGATAATGATTTTGTGTTTCAGG - Intergenic
987588919 5:19896609-19896631 TGATACTGACTTTGGACTTCTGG + Intronic
987964247 5:24851483-24851505 TGAAACTCATTTTTGATTTCTGG - Intergenic
988264830 5:28935152-28935174 TGATACTTACTTTGGACTTGTGG - Intergenic
988713418 5:33801176-33801198 TGAAACCGATTTTGGACTTCTGG + Intronic
989001587 5:36766481-36766503 TGAAACTAATGTTGGACTTCTGG - Intergenic
989202731 5:38781215-38781237 GGATACTGATTTCAGACTCCTGG + Intergenic
989350869 5:40485189-40485211 TGAGGCTGATTTTGAAATTCAGG - Intergenic
989458057 5:41665032-41665054 TAATACAGATTTTGTACTTGAGG - Intergenic
990313667 5:54564527-54564549 TGAGACCTATTTTGGACCTCTGG - Intergenic
990374127 5:55152213-55152235 TGAAACTGAGTTTGGACCTCTGG + Intronic
990412495 5:55554743-55554765 TGAAACTGACTTAGGATTTCTGG + Intergenic
990624577 5:57597222-57597244 GGAAACCCATTTTGGACTTCCGG - Intergenic
991187612 5:63828625-63828647 TGATACAGATTTGGGAGTTGTGG + Intergenic
991471615 5:66975213-66975235 TGACACTGATTTCAGATTTCTGG + Intronic
991608014 5:68422588-68422610 TGAAACCCATTTTGGACTTCTGG + Intergenic
992183834 5:74224575-74224597 TGAAACTGATTTGGGACTTCTGG + Intergenic
992440102 5:76790276-76790298 TGATACAGATTTCAGACTTCTGG + Intergenic
992946696 5:81818204-81818226 TGATACTGCTTTCAGACTTCCGG - Intergenic
993082822 5:83322848-83322870 TGTTACTGATTTCAGACTTCTGG + Intronic
993199023 5:84788855-84788877 CAATACTGATTTTGGATTTTTGG - Intergenic
994013898 5:94942400-94942422 TGACTATGATTTTGGACTACAGG - Exonic
994321901 5:98404188-98404210 TGGGACTGATTTTGAACTTCTGG + Intergenic
994448306 5:99906360-99906382 TGATTATGATTTGGCACTTCAGG + Intergenic
994724360 5:103416756-103416778 TGAAACTAATTTTTAACTTCTGG - Intergenic
994780824 5:104087938-104087960 TGAAAGTGATTTTGAATTTCTGG - Intergenic
994896553 5:105711316-105711338 TGATACTGATTTTTGACTTCTGG + Intergenic
995430302 5:112067446-112067468 TGATATTTATTTCAGACTTCTGG - Intergenic
995470861 5:112500846-112500868 AGATACTGATTTTGGACCTCAGG - Intergenic
995602292 5:113810661-113810683 TGGTATTGATTTTGGACTTCTGG + Intergenic
996206367 5:120742762-120742784 TGAGACTCATTGTGGACTTATGG - Intergenic
996572876 5:124951394-124951416 TGGCCCTGAATTTGGACTTCCGG + Intergenic
996602089 5:125276346-125276368 TGATACTGACTTGGGATTTGAGG + Intergenic
996608346 5:125350231-125350253 TAGTACTGCTTTTGGACTTGAGG + Intergenic
996612499 5:125399405-125399427 TGACTCTGATGTTTGACTTCAGG + Intergenic
996767069 5:127045256-127045278 TGAAACTGATTTCTGACTTCTGG - Exonic
996876516 5:128246300-128246322 ACATCCTGATTTTGGACTTCAGG + Intergenic
996946626 5:129078270-129078292 TGGTATTTATTTTGGACTTCTGG + Intergenic
996993657 5:129668006-129668028 TGAAACTGATTTTGGACTTCTGG - Intronic
997229366 5:132231534-132231556 ACATTTTGATTTTGGACTTCTGG - Intronic
997648981 5:135501176-135501198 GCACCCTGATTTTGGACTTCTGG - Intergenic
997738160 5:136229642-136229664 TGATGTTGATCTTGGACTTGTGG + Intronic
998065732 5:139156805-139156827 TGACACTGATTTCAGACTTCTGG + Intronic
998279511 5:140792078-140792100 ACACGCTGATTTTGGACTTCTGG - Intronic
999074766 5:148783896-148783918 AGATCTTTATTTTGGACTTCTGG - Intergenic
999411334 5:151352552-151352574 TGAAACTGATTTAGGGCTTCTGG - Intergenic
999460540 5:151754223-151754245 GGATTCTGATTCCGGACTTCTGG - Intronic
1000248292 5:159468610-159468632 TGAGACCCATGTTGGACTTCTGG + Intergenic
1000788868 5:165580220-165580242 TGAAACTTATTTTGAACTTCTGG + Intergenic
1000958800 5:167574354-167574376 TGATACTGCTTTTGAACTCCGGG + Intronic
1001248685 5:170126862-170126884 TGAAACTGGTTTCAGACTTCTGG + Intergenic
1001445378 5:171778662-171778684 TGCTACTGACTTTAGACTTATGG + Intergenic
1001793792 5:174484549-174484571 TGATACTGATTTTGGACTTCAGG - Intergenic
1001813119 5:174645794-174645816 TGCTACTGATTTCAGACTTGTGG - Intergenic
1001939964 5:175733428-175733450 TGAGACCCATTTTCGACTTCTGG - Intergenic
1002079978 5:176732058-176732080 TGACAATGATTTTGGACTTCTGG - Intergenic
1002852873 6:1011973-1011995 TGAGACCGATGTTGGGCTTCTGG - Intergenic
1002942734 6:1732541-1732563 CGTTACTGATTTTGCCCTTCTGG - Intronic
1003331089 6:5129332-5129354 TGAAACTGATTTTTGACTTCTGG - Intronic
1003416181 6:5910470-5910492 TGAGACTAATTTTGGTCTTCTGG - Intergenic
1003742418 6:8956834-8956856 GGATACTGATTTTGGACTTCTGG + Intergenic
1004472000 6:15937835-15937857 ACATCTTGATTTTGGACTTCTGG + Intergenic
1004487818 6:16084113-16084135 TGATACTGATTTTGGACTTCTGG - Intergenic
1004493049 6:16135457-16135479 TGATTCTCATTTTGTACTTTGGG + Intronic
1004917719 6:20347306-20347328 TGATCATGATTTTGGATTTCTGG + Intergenic
1005708106 6:28477222-28477244 TGATACTGAGTTTGGACTTTTGG - Intergenic
1005763345 6:28987594-28987616 ACATACTGATTGTGGATTTCTGG + Intergenic
1007851995 6:44812169-44812191 TGAGACTTATACTGGACTTCTGG - Intronic
1007981943 6:46168619-46168641 TGATCCAGACTTTTGACTTCTGG + Intronic
1008191243 6:48461140-48461162 TGATGCTGATTTCAGGCTTCCGG + Intergenic
1008393243 6:50977662-50977684 TGATACTGACTTCAGACTTCTGG - Intergenic
1008770707 6:54975456-54975478 AGACCTTGATTTTGGACTTCTGG + Intergenic
1009194620 6:60669092-60669114 TGATACTGATCTTGAACTACTGG - Intergenic
1010435777 6:75828931-75828953 TGGTTTTGATTTTTGACTTCTGG + Intronic
1010623156 6:78101707-78101729 TGAAACTGATTTTAGACTTCAGG + Intergenic
1010736159 6:79445496-79445518 ATATCTTGATTTTGGACTTCTGG + Intergenic
1010928328 6:81770462-81770484 TGATACCGATTTTGGGCTTTTGG - Intergenic
1011379362 6:86725898-86725920 TGAAACTGATTTTAGATTTCTGG - Intergenic
1011820450 6:91247223-91247245 TAATACCGATTTTGGACTTCTGG - Intergenic
1012008932 6:93754865-93754887 CGATACTGATTTTGGGTTTCTGG + Intergenic
1013204344 6:107933274-107933296 AGAAACTGATTTTGGACTTCTGG + Intronic
1013289055 6:108705377-108705399 TGATTCTGATTTTAGACATTTGG - Intergenic
1013393095 6:109706330-109706352 TGATTCTGAATTTGGCCTTGAGG - Intronic
1013429007 6:110039533-110039555 GGAAATTGATGTTGGACTTCTGG - Intergenic
1013955556 6:115836450-115836472 TGAGACAGATTTTGGTTTTCTGG + Intergenic
1014297805 6:119642001-119642023 TGATAATGATATTTGAATTCTGG + Intergenic
1014726652 6:124979218-124979240 TGATGCTGATTGTTGACTTAAGG + Intronic
1014857469 6:126419635-126419657 TGAAACCAATTTCGGACTTCTGG - Intergenic
1014998759 6:128188679-128188701 TGGTACTGATTTCAGATTTCTGG - Intronic
1015061908 6:128976396-128976418 TGATAATGATTTGGGAATTTTGG + Intronic
1015402469 6:132801625-132801647 TGAAACTGATGTTGAACTTCTGG - Intergenic
1015662140 6:135588059-135588081 AGATTTTGATTTAGGACTTCTGG + Intergenic
1016299534 6:142614766-142614788 TGATACTAATATTGGACTTCTGG - Intergenic
1016300920 6:142630457-142630479 GGATACAGAGTTTGGAGTTCAGG + Intergenic
1016384307 6:143515814-143515836 TGATTCTCATTTAGGACTTCAGG - Intergenic
1016725863 6:147366428-147366450 TAAAACTGATTGTGGACTTCTGG - Intronic
1017575207 6:155794564-155794586 TGATACTGACTTTGGACTTCTGG + Intergenic
1017594950 6:156018353-156018375 TGATACTGACTTTGGGCTTCTGG - Intergenic
1017954455 6:159167424-159167446 TGGAACTGATTTCAGACTTCTGG - Intergenic
1018000727 6:159576339-159576361 TGAGACTGATTTCAGACTTCTGG + Intergenic
1018485108 6:164233034-164233056 TGTTACTGAGGTTGGAGTTCAGG - Intergenic
1018512478 6:164540402-164540424 TGAACCTGATTTTAGACTTCTGG - Intergenic
1018830450 6:167438524-167438546 TAAAACTGATATTGTACTTCTGG - Intergenic
1019373092 7:673814-673836 TGATCCTGGATCTGGACTTCTGG - Intronic
1019578257 7:1748025-1748047 TTTTACTGATTTTGGCCTTGGGG + Intergenic
1019788121 7:2992488-2992510 ACACCCTGATTTTGGACTTCTGG - Intronic
1019883767 7:3885803-3885825 TGTTACTTATTTTGAACTTTGGG - Intronic
1019952092 7:4381939-4381961 GCATTTTGATTTTGGACTTCTGG - Intergenic
1020324304 7:6962438-6962460 TTTGATTGATTTTGGACTTCTGG + Intergenic
1020602614 7:10294680-10294702 TGATACTGATGATGAATTTCTGG + Intergenic
1020613662 7:10432062-10432084 TTAGACCCATTTTGGACTTCTGG - Intergenic
1020718106 7:11704243-11704265 TGCTGATGATTTTGGATTTCAGG - Intronic
1020814208 7:12884696-12884718 TGATCCTGATTTTGGAAGTTAGG + Intergenic
1020975747 7:15003927-15003949 TGGAAATGATTTTTGACTTCTGG - Intergenic
1021239286 7:18180799-18180821 TGAAACTGATTTTGGACTTCTGG - Intronic
1021516951 7:21499599-21499621 AGATCTTAATTTTGGACTTCTGG + Intronic
1022396870 7:29996526-29996548 TAATACTGATTTCAGACATCTGG - Intergenic
1022711832 7:32857946-32857968 TGATGCTTGTTTTGGACATCTGG + Intergenic
1022793249 7:33710768-33710790 TGGTAGTGATGTTGGACTTCTGG - Intergenic
1022900759 7:34808232-34808254 TAGAACTAATTTTGGACTTCTGG + Intronic
1022912826 7:34917010-34917032 TGATGCTTGTTTTGGACATCTGG - Intergenic
1023107654 7:36778514-36778536 TGAAACCCATTTTGGACTTCTGG - Intergenic
1024779221 7:52827129-52827151 TGATCATCATTTTGAACTTCAGG + Intergenic
1024851422 7:53721766-53721788 TGTTAGTGATTTCGGACATCAGG - Intergenic
1026504043 7:70967250-70967272 TGATACTCACTTTGGAGTACTGG - Intergenic
1026534446 7:71228492-71228514 TGGTATTGATTTTGGACATCTGG - Intronic
1026634474 7:72069409-72069431 TGATACTGATTTCAGACTTCTGG - Intronic
1026638996 7:72108041-72108063 TGATGCTGATTTTGGAATTTTGG - Intronic
1026975049 7:74492698-74492720 TGGTAATGATTTTGGACCTTTGG - Intronic
1027212748 7:76164196-76164218 TGGGACTGATTTTAGAATTCTGG + Intergenic
1027566902 7:79806569-79806591 TGACACTGATTTTGGACGCCTGG + Intergenic
1027907558 7:84205586-84205608 TTATACTGTTTCTAGACTTCTGG - Intronic
1028199407 7:87943556-87943578 TAAAAATGATTTTTGACTTCTGG + Intronic
1028232315 7:88320063-88320085 GCATCTTGATTTTGGACTTCTGG + Intergenic
1028305879 7:89263859-89263881 ACATTTTGATTTTGGACTTCTGG + Intronic
1028510829 7:91624619-91624641 AGATACTGATTTCAGACTTCTGG - Intergenic
1028723302 7:94058543-94058565 TGCAACTGATTTCAGACTTCTGG + Intergenic
1028885651 7:95929664-95929686 AGAGACTGAATATGGACTTCTGG - Intronic
1029278023 7:99419030-99419052 TGCTACTGTTTGGGGACTTCAGG - Exonic
1030286412 7:107831548-107831570 TAATACTGATTTGAGACTTCTGG + Intergenic
1030661837 7:112228007-112228029 ACATCTTGATTTTGGACTTCTGG - Intronic
1031233163 7:119136392-119136414 CGATACTGATTTTGGATTAGTGG - Intergenic
1031399003 7:121309262-121309284 ATATCTTGATTTTGGACTTCTGG - Intergenic
1032974060 7:137201276-137201298 TAAGACTGATTTGGGACCTCCGG + Intergenic
1033263141 7:139860742-139860764 TGAGGTTGATTTTGGACTTCTGG + Intronic
1033400287 7:141016436-141016458 TGATGCTGATTTTGAATTTATGG - Intergenic
1033547368 7:142413646-142413668 TTACACTGATTTTGGACTCCTGG - Intergenic
1033668177 7:143463527-143463549 TGATTCTTATTTGGGACTTGTGG + Intergenic
1033865340 7:145684842-145684864 TCAAACTGATTTTAGACTTCTGG + Intergenic
1034230441 7:149522379-149522401 TGAAACTCATTTTGGACTTCTGG - Intergenic
1034509756 7:151524082-151524104 TGACACTGATTTCCGGCTTCCGG + Intergenic
1034938927 7:155217880-155217902 TGATTATGATCTGGGACTTCTGG - Intergenic
1035637699 8:1159339-1159361 GGATACTGATTTTGATTTTCAGG + Intergenic
1036002036 8:4616815-4616837 AGAAACTCATTTTGGTCTTCTGG + Intronic
1036371759 8:8168526-8168548 TTTGATTGATTTTGGACTTCTGG - Intergenic
1036407707 8:8469786-8469808 GGATACTGATTTGGGACTTTTGG + Intergenic
1036509703 8:9388918-9388940 TGATACTGATTTCAGACTTCTGG + Intergenic
1036879142 8:12497118-12497140 TTTGATTGATTTTGGACTTCTGG + Intergenic
1037532592 8:19792145-19792167 ACACACTGATTTTGGACTTCTGG - Intergenic
1037555075 8:20014268-20014290 TCACCCTGATTTTGGATTTCTGG + Intergenic
1038043789 8:23749193-23749215 GAGAACTGATTTTGGACTTCTGG + Intergenic
1038062065 8:23924927-23924949 TGATACTGATTTTGGACTTCTGG - Intergenic
1039176856 8:34818188-34818210 CAACACCGATTTTGGACTTCAGG + Intergenic
1040131958 8:43807512-43807534 TGAAACTGCTTTTTGATTTCTGG + Intergenic
1040137582 8:43872980-43873002 TGAGACTGATTTTGGAGGTGTGG + Intergenic
1040485181 8:47864326-47864348 TGAAACTGATTCTGGACTTCTGG + Intronic
1041153067 8:54956425-54956447 ACAAACTAATTTTGGACTTCTGG - Intergenic
1041807539 8:61869239-61869261 TTATACTGATTTTGAAGTTCAGG + Intergenic
1041880653 8:62746069-62746091 TGAAGCTGATTTCAGACTTCTGG - Intronic
1042867551 8:73368998-73369020 CCATTCTGATTTTGGACGTCTGG + Intergenic
1042940362 8:74101016-74101038 TGACACTAATTTTGGACTTTTGG + Intergenic
1043358562 8:79442087-79442109 TGATATTGGTTTTGGACTTCTGG + Intergenic
1043716883 8:83498269-83498291 TGATACTGAAGTTAGACTTGTGG - Intergenic
1043977375 8:86598569-86598591 ATATTTTGATTTTGGACTTCTGG - Intronic
1044131628 8:88530905-88530927 TCACTGTGATTTTGGACTTCTGG + Intergenic
1044233757 8:89807429-89807451 TGAAACTGATTTTGGACTTTTGG + Intergenic
1044237831 8:89852358-89852380 TAAGACTCATTTTGGACTTAAGG - Intergenic
1044728799 8:95214022-95214044 TGATGCTAATTTTGGACTTCTGG + Intergenic
1045664842 8:104473236-104473258 TGAAGCTAATTTTGAACTTCTGG - Intergenic
1045677625 8:104626031-104626053 TGATACTGATTTTGGATTTTTGG - Intronic
1045796596 8:106052688-106052710 TGAAATAGATTTTTGACTTCAGG - Intergenic
1046165688 8:110431928-110431950 TAAAACTGATTTTCTACTTCTGG - Intergenic
1046282017 8:112045588-112045610 TGATACCAATTTTGGACTTCTGG + Intergenic
1046808366 8:118504993-118505015 AGACATTGACTTTGGACTTCTGG + Intronic
1047496023 8:125409479-125409501 TAAGACCCATTTTGGACTTCTGG - Intergenic
1047717776 8:127611450-127611472 TGAAACTGACTTTGAAATTCTGG + Intergenic
1047908102 8:129494563-129494585 CAAGACTCATTTTGGACTTCTGG - Intergenic
1047929720 8:129714551-129714573 TGATACTGATTTTCCATTTATGG + Intergenic
1048283006 8:133119089-133119111 TCAAACTGGTTTTGGGCTTCTGG + Intronic
1048426678 8:134329746-134329768 TGACACGAATTTTGGATTTCCGG + Intergenic
1048450264 8:134527273-134527295 TGAGACTCATTTTGGACTTCTGG + Intronic
1048453812 8:134558812-134558834 TGATAGTGATGTTTGTCTTCTGG - Intronic
1048996665 8:139798845-139798867 TGGTTCTGATTTCAGACTTCTGG - Intronic
1049149461 8:141025261-141025283 TGAGACCCATATTGGACTTCTGG - Intergenic
1049539530 8:143201701-143201723 TGAGCCAGATTTAGGACTTCAGG - Intergenic
1050027387 9:1349935-1349957 TGATACTGATTTTGGGTTTTTGG + Intergenic
1050593139 9:7180430-7180452 TGAAACTGATTTCAGACGTCTGG + Intergenic
1050760714 9:9066849-9066871 TGACTCTGATTTTGTTCTTCTGG + Intronic
1050851431 9:10291717-10291739 TGAAACTTATTTCAGACTTCTGG + Intronic
1050948624 9:11559215-11559237 TGATAATGATTTCAGACTTCTGG + Intergenic
1051000147 9:12271996-12272018 TGATAGTGCTTTTTGACTTTTGG + Intergenic
1052161247 9:25262582-25262604 TGATACTGATTTTGAAGTTCTGG + Intergenic
1052293103 9:26866822-26866844 TTGTAGTGATTTTGGGCTTCTGG - Intronic
1053268105 9:36730696-36730718 TGAGACTGATTTGAGGCTTCTGG - Intergenic
1053398048 9:37792754-37792776 TCAGCCTGATTTTGAACTTCTGG + Intronic
1053767822 9:41427308-41427330 TGATACTGATTATGAATTTTTGG + Intergenic
1054141140 9:61531225-61531247 TGTGACCCATTTTGGACTTCCGG - Intergenic
1054319053 9:63634515-63634537 TGATACTGATTATGAATTTTTGG - Intergenic
1054869467 9:70036131-70036153 TGCCACTGATCTTGGTCTTCTGG - Intergenic
1055536113 9:77246644-77246666 TGATGCTGATACTGGACTTAGGG + Intronic
1055697999 9:78909068-78909090 TAAGACTCATTTTGGACTTCTGG + Intergenic
1055875111 9:80932737-80932759 TCATTCTGAATTTGGACTCCAGG + Intergenic
1055991510 9:82111196-82111218 TGATACTGATTTTGGACTTCTGG + Intergenic
1056284227 9:85071605-85071627 TGATATTGATTTTGGACCTTTGG + Intergenic
1056288199 9:85112658-85112680 TGAAACTGATTTCAGACTTTTGG + Intergenic
1056491667 9:87114124-87114146 TGATATTGATTTCAGACTTCTGG + Intergenic
1057015459 9:91647176-91647198 AGAGACTGATTGGGGACTTCAGG + Intronic
1057540210 9:95960687-95960709 TGATACTGATTTCAGATTTCTGG + Intronic
1057902017 9:98956814-98956836 TGATTCTGATTTATGAGTTCTGG - Intronic
1058222852 9:102324488-102324510 TAAAACTGATTTTGGACTTCTGG + Intergenic
1058375847 9:104320559-104320581 TGATACTGATTTCAGGCTTCTGG + Intergenic
1058385090 9:104426902-104426924 TGAAACTGATGTTGAATTTCTGG + Intergenic
1058949715 9:109892140-109892162 GTATCTTGATTTTGGACTTCTGG - Intronic
1059463180 9:114448372-114448394 TCACCTTGATTTTGGACTTCTGG + Intronic
1059561262 9:115336862-115336884 TAATACTGATTTTGGACTCTTGG - Intronic
1059711135 9:116868692-116868714 AAACCCTGATTTTGGACTTCTGG - Intronic
1059747923 9:117220712-117220734 ACATCATGATTTTGGACTTCTGG + Intronic
1059843647 9:118246616-118246638 TGGAACTGATTTCTGACTTCTGG - Intergenic
1060530329 9:124343956-124343978 CGAGACTGATTTTGGACATCTGG - Intronic
1061461923 9:130746879-130746901 TGATACTAATTTCAGATTTCTGG - Intronic
1062319667 9:135984608-135984630 TGTTCCTGATTTTGGGCATCCGG - Intergenic
1062483028 9:136761205-136761227 ACATCTTGATTTTGGACTTCTGG + Intronic
1202786130 9_KI270719v1_random:21474-21496 TGATACTGATTATGAATTTTTGG - Intergenic
1185935755 X:4256091-4256113 TGACACTGATCTTGAATTTCTGG - Intergenic
1186442542 X:9598711-9598733 ACATCTTGATTTTGGACTTCTGG - Intronic
1186594063 X:10961386-10961408 TGAAACTCATGTTGGATTTCTGG + Intergenic
1186625682 X:11290806-11290828 TGACACTTATTTTTGACTGCTGG - Intronic
1186698912 X:12068255-12068277 TGAAACCCATTTTGGACTTCTGG + Intergenic
1188274932 X:28188595-28188617 TGATACTGATTTTAGACTTCTGG - Intergenic
1188451458 X:30311212-30311234 TGAAACTGATTTCAGACTTCTGG - Intergenic
1188467866 X:30503040-30503062 TGAAACTGATTTTGGACTTCTGG + Intergenic
1188819964 X:34763042-34763064 TGAAACTGATGTAGGACTTCTGG + Intergenic
1188954694 X:36420054-36420076 TGACACTGATCTTAGATTTCTGG + Intergenic
1188976764 X:36684819-36684841 TGATACTGAATTTGTACTTCTGG + Intergenic
1189220798 X:39369988-39370010 TGAGACTGATTTTAGACATCTGG + Intergenic
1189365482 X:40384719-40384741 TGACAATGATTTGGGGCTTCCGG - Intergenic
1189576540 X:42359652-42359674 TAAAACTGACTGTGGACTTCTGG - Intergenic
1189900642 X:45702620-45702642 TTAGACTGATTTTGGATTTCTGG + Intergenic
1190002287 X:46700629-46700651 GTACACTGATCTTGGACTTCTGG + Intronic
1190097660 X:47494781-47494803 TGATATTGATTTCAGACTTCTGG - Intergenic
1190097887 X:47496979-47497001 CCATACTGATTTTAGATTTCTGG - Intergenic
1190170178 X:48106109-48106131 TGAAACTGATTTCAGATTTCTGG + Intergenic
1190188092 X:48253465-48253487 TGAAACTGATTTCAGATTTCTGG + Intronic
1190284049 X:48950479-48950501 TGAAACTGATTGTGGACTTCTGG + Intronic
1190299653 X:49049562-49049584 TGCAACTGATTTTAGACTTCTGG + Intergenic
1190425057 X:50328133-50328155 TGAGACTCATTTTGGCCTTCTGG + Intronic
1190656983 X:52621232-52621254 TGAAACTGATTTCAGATTTCTGG + Intergenic
1190961699 X:55256264-55256286 AGATACTGATTTTGAATTTCAGG - Intronic
1191112149 X:56812347-56812369 GGATTCTGATTATGCACTTCAGG - Intergenic
1191219900 X:57976981-57977003 TGATACTGATTTTGGATCTCTGG + Intergenic
1192269338 X:69564236-69564258 TGGAACTGATTGTGGACTTCAGG - Intergenic
1192431236 X:71113385-71113407 CCACACTGATTTCGGACTTCTGG - Intergenic
1193179503 X:78437646-78437668 ATATATTTATTTTGGACTTCAGG + Intergenic
1193187085 X:78526203-78526225 TGATATTGATTTTGTAATTGGGG + Intergenic
1193984680 X:88226198-88226220 TCATGCTGATCTTGGACTACAGG - Intergenic
1194408396 X:93526813-93526835 TGATACTGAGTTTGGACTTTTGG + Intergenic
1194514292 X:94831189-94831211 TGATACTTATTTTGAATGTCTGG - Intergenic
1195262516 X:103146922-103146944 TGAAACTGATTTTGAACTTCTGG + Intergenic
1195433453 X:104815270-104815292 TGATACCCATTTTGGACTCCTGG - Intronic
1195707614 X:107749498-107749520 TCAAACTGATCTTGAACTTCTGG + Intronic
1196053475 X:111330555-111330577 TGATTCTGATTTTTAATTTCAGG + Intronic
1196151189 X:112376312-112376334 TAATACTGATTTTAGTCTTTGGG - Intergenic
1196407997 X:115385863-115385885 TGAAGCTGATTTTGGACTTCTGG + Intergenic
1196651013 X:118168390-118168412 TGGTCATGATTTTGTACTTCTGG - Intergenic
1196686528 X:118514961-118514983 TGATACTTATTTCAGACGTCTGG - Intronic
1197249143 X:124196590-124196612 TAAGACTCATTTTGGACTTCTGG + Intronic
1197824453 X:130573765-130573787 TGATATTGAATTTGGACATTTGG - Intergenic
1197887615 X:131234926-131234948 TGAAACTGATTTCAGACTTCTGG - Intergenic
1198112627 X:133515000-133515022 TAATACTGATTTTGGATTTCTGG - Intergenic
1198507002 X:137310866-137310888 TTATAATGATTTTGGACTTCTGG + Intergenic
1198588816 X:138153321-138153343 TTACACTGATTTTATACTTCTGG + Intergenic
1198687680 X:139244806-139244828 TGATACTGATTTCAGATTTCTGG + Intergenic
1199203618 X:145122652-145122674 TAATACTGATTTCAGATTTCTGG - Intergenic
1199402496 X:147415469-147415491 TGAGACTCATTTTGGATTTCTGG - Intergenic
1199480012 X:148288171-148288193 TGAAACTGATTTTGTATTTCTGG - Intergenic
1199692455 X:150318900-150318922 TGATACTGATTTTGGACTTCTGG + Intergenic
1199768813 X:150960403-150960425 AGATACTGATTTTAGACTTCCGG - Intergenic
1199936462 X:152579010-152579032 TGATTCTGATTTTTATCTTCTGG + Intergenic
1199973314 X:152876489-152876511 TGAAGCTGATTTTGGGGTTCTGG - Intergenic
1201186399 Y:11407886-11407908 TGATATTGATATTGGTCATCAGG - Intergenic
1201538275 Y:15075959-15075981 TGATAATGACTATGGAATTCAGG + Intergenic
1201652414 Y:16304328-16304350 TGATGTTAATTTTGGACTCCAGG + Intergenic
1201686624 Y:16711770-16711792 TGAAAATGGTTTTGGACTCCTGG + Intergenic