ID: 1055993433

View in Genome Browser
Species Human (GRCh38)
Location 9:82131605-82131627
Sequence TTGTAGCCATAGCTGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 19, 2: 17, 3: 31, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055993433_1055993437 19 Left 1055993433 9:82131605-82131627 CCAGGCTCCAGCTATGGCTACAA 0: 1
1: 19
2: 17
3: 31
4: 171
Right 1055993437 9:82131647-82131669 AAAAATAAAGTGAATTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055993433 Original CRISPR TTGTAGCCATAGCTGGAGCC TGG (reversed) Intergenic
901758055 1:11453361-11453383 TTGCAGCCTGAACTGGAGCCTGG - Intergenic
902120261 1:14159205-14159227 TTCTGGACATACCTGGAGCCTGG - Intergenic
902500376 1:16907135-16907157 TGGTCGCCAGAGCTGGGGCCTGG + Intronic
903163889 1:21508074-21508096 TTGGAGCCAGAACTGGGGCCTGG - Intergenic
903564532 1:24254870-24254892 TCCCAGCTATAGCTGGAGCCAGG + Intergenic
904709846 1:32421938-32421960 TGGAAGCCAGAGCTGCAGCCAGG + Intergenic
904786690 1:32988214-32988236 TTGTATACATAGCTGGAGCCTGG - Intergenic
905420728 1:37841656-37841678 TTATAGCCACAGTTGGAGCCTGG - Intronic
905473249 1:38208362-38208384 TTGTGACCAGAGCTGGGGCCTGG + Intergenic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
906302841 1:44696124-44696146 TTGCTGCCATAGTTGGGGCCAGG - Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
907468247 1:54653830-54653852 CTGATACCATAGCTGGAGCCAGG - Exonic
908038062 1:60077250-60077272 TTTCAGGCATAGCTGGATCCAGG - Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912905221 1:113698883-113698905 TGGTGGCCATAGCTAGAGCTTGG + Intronic
913100434 1:115559118-115559140 TTGTAGCCATTGTTGGAGTCTGG - Intergenic
913595459 1:120371765-120371787 TTGAAACCATAGCAGGAGGCAGG - Intergenic
913803045 1:122742724-122742746 TTGTGGCCTTCGCTGGAACCGGG + Intergenic
914091815 1:144507210-144507232 TTGAAACCATAGCAGGAGGCAGG + Intergenic
914595325 1:149146148-149146170 TTGAAACCATAGCAGGAGGCAGG + Intergenic
915035880 1:152924423-152924445 TGGTTGCCATAGCTACAGCCTGG + Intergenic
916091256 1:161309424-161309446 TGGTGGCCATGGCTGGACCCAGG - Intronic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
916523109 1:165582451-165582473 TTGTAGCTACAGCTGGAGCCTGG - Intergenic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
920332719 1:205222495-205222517 TTGTTGCCCAGGCTGGAGCCAGG + Intergenic
920864083 1:209736974-209736996 GTGATGCCATAGCTGGAGACTGG - Intergenic
923338574 1:232989983-232990005 TTCTCCCCATAGCTGGAGACTGG + Intronic
1064270402 10:13860045-13860067 TTGTAGCATTTGCTGGAGCCTGG + Intronic
1066139575 10:32489818-32489840 TTCAAGCCAGTGCTGGAGCCTGG + Intronic
1066822051 10:39507588-39507610 TTGAAGCCATCGCTGGAAACGGG + Intergenic
1067249196 10:44573083-44573105 CTGCAGGCATAGCTGGATCCAGG - Intergenic
1068986682 10:63114111-63114133 GTCTAGCCAAAGCTGAAGCCTGG + Intergenic
1071851811 10:89580479-89580501 TCTTTGCTATAGCTGGAGCCTGG - Exonic
1072915833 10:99536925-99536947 TGGTAGCCCTGGCTGCAGCCAGG - Intergenic
1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG + Intronic
1073140281 10:101242632-101242654 TGGCAGCCATGCCTGGAGCCTGG + Intergenic
1075972650 10:126667767-126667789 ATGTAGCCATAACTGGAGGATGG - Intronic
1079058717 11:17229124-17229146 TTGTAGCCACAGCTAGAGCCTGG - Intronic
1081230471 11:40579981-40580003 TTGTAGAGATAGCTGTAACCAGG + Intronic
1082164672 11:48931456-48931478 TTGTAGCCTTCGCTGGAAACGGG - Intergenic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1085468495 11:76740383-76740405 TTGTAGCAATAGCTGATTCCAGG + Intergenic
1085965032 11:81513165-81513187 TTTTAGCCACAGCTGAAGCAGGG - Intergenic
1086954836 11:92925332-92925354 TTTTAGCCATAACTGGAGCTAGG - Intergenic
1086958941 11:92962439-92962461 TGGAAGCCAGAGCTGGAACCAGG - Intergenic
1087071566 11:94086593-94086615 ATGTAGCCATAACTGCAGCCTGG + Intronic
1087130518 11:94665819-94665841 TTGAAGCCATTGCTGCAGGCTGG - Intergenic
1088270628 11:108030598-108030620 TTGTTGCCCAAGCTGGAGCGCGG - Intronic
1091334260 11:134754632-134754654 ATGTAGTCATCCCTGGAGCCTGG + Intergenic
1092487747 12:8916843-8916865 TAGTAGCCTGAGCTGGAACCAGG + Intronic
1098614636 12:72507910-72507932 TTTTAGCCACTGCTGGAGCTAGG - Intronic
1099756892 12:86863053-86863075 TTGTAGAAATGGATGGAGCCTGG - Intergenic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1101526414 12:105535179-105535201 TTTTAGCCATAGCTGGACACAGG + Intergenic
1101579192 12:106026647-106026669 TTTCAGGCATAGCTGGATCCAGG - Intergenic
1103258840 12:119566759-119566781 TTTCAGCCATAGCAGGATCCAGG + Intergenic
1106396402 13:29385100-29385122 TTGTACCAACAACTGGAGCCTGG - Intronic
1106433990 13:29707992-29708014 TTGCAGACAGAGGTGGAGCCGGG - Intergenic
1108512581 13:51169665-51169687 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1108724333 13:53163746-53163768 TTTCAGCCATGGCTGGAGTCAGG + Intergenic
1108770950 13:53699947-53699969 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1109297542 13:60552861-60552883 TTTTAGCCATGGCTGGAGCTGGG + Intronic
1112790307 13:102995510-102995532 TTTTAGCCACGGCTGGAGCTGGG + Intergenic
1115289277 14:31751984-31752006 TTTTAGCCATGGCTGGAGCCTGG + Intronic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1117658666 14:57982405-57982427 CTGTGGACATAGCTGGTGCCTGG - Intergenic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1120199116 14:81517500-81517522 TTGTAGCAAGAGCAGCAGCCAGG - Intronic
1121441375 14:93951808-93951830 TAGTAGCCTTTGCTGGAGCAGGG - Intronic
1122183830 14:99974332-99974354 TAATAGCCATAGCTGGAGCCTGG + Intronic
1122912131 14:104835999-104836021 TTGTAGCCACAGCAGGAGCCTGG + Intergenic
1123754832 15:23389026-23389048 TGGTAGCCAGATCTGGAGGCAGG + Intergenic
1129424285 15:75453224-75453246 TCGAAGCCATCGCTGGAGTCAGG - Intronic
1129981247 15:79873166-79873188 ATATATCTATAGCTGGAGCCTGG - Intronic
1131541580 15:93279541-93279563 CAGGAGCCAAAGCTGGAGCCTGG + Intergenic
1131889646 15:96958819-96958841 TTGTAGCTGGAGCTGGAGCCAGG + Intergenic
1134461540 16:14433954-14433976 TGGTAGCCAGATCTGGAGGCAGG - Intergenic
1135331950 16:21567763-21567785 TAAAAGCCACAGCTGGAGCCAGG - Intergenic
1137451329 16:48577529-48577551 TTGCAGCCACAGCTGCAGCCTGG + Intronic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1139160283 16:64497860-64497882 TAGTAGACAGAGCAGGAGCCTGG + Intergenic
1139550032 16:67667830-67667852 TGGGAGCCAGGGCTGGAGCCTGG + Intronic
1139657748 16:68399284-68399306 TTGAACCCAGAGCAGGAGCCAGG - Intronic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1140801032 16:78488550-78488572 TTTTGGCCCTACCTGGAGCCTGG + Intronic
1142588228 17:987678-987700 TTTCAGCCATGGCTGCAGCCAGG + Intergenic
1146221027 17:31020710-31020732 TTTTAGGCACAGCTGGATCCCGG + Intergenic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1148961563 17:51397567-51397589 TTGGGGCCAGAGTTGGAGCCAGG + Intergenic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1150366726 17:64594425-64594447 TTTTAGGCACAGCTGGATCCCGG - Intronic
1151348202 17:73516201-73516223 TGGTAGAGACAGCTGGAGCCTGG + Intronic
1151715222 17:75827738-75827760 TTGCAGCCAGGGCTGGAGGCAGG + Exonic
1153107958 18:1549993-1550015 TTTTGGCCACAGCTGGAGCTGGG - Intergenic
1154156518 18:11948071-11948093 CTGCAGCCGGAGCTGGAGCCAGG + Intergenic
1157222882 18:45839910-45839932 TTGTGGCCACAGCAGCAGCCAGG - Intronic
1157757744 18:50233672-50233694 TTGCCTCCATGGCTGGAGCCAGG + Intronic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160533419 18:79578259-79578281 GTGGAGCTATAGCTGGTGCCTGG + Intergenic
1160742080 19:691148-691170 TTGTAACCACAGCTGGAGCCGGG - Intronic
1161960526 19:7520602-7520624 TTGCGGCCAGAGCTGGTGCCAGG - Exonic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1164697900 19:30260704-30260726 TGGTGGCCATGGCTGGTGCCTGG - Intronic
925604148 2:5641120-5641142 TTGAAACCATAGCAGGAGGCAGG - Intergenic
926130765 2:10302356-10302378 AGGTAACCAGAGCTGGAGCCAGG + Intergenic
927801178 2:26101322-26101344 TAGCAGCCACAGCTGGAGCCTGG + Intronic
928914908 2:36460134-36460156 ATGTAACCACAGCTGCAGCCAGG - Intronic
933659636 2:84916638-84916660 TTGTAGCCACATCTGAAGCCTGG - Intergenic
934714468 2:96535647-96535669 TTGGAGCCAGAGCTAGACCCAGG - Intergenic
935976604 2:108584844-108584866 TTGGGGACATAGATGGAGCCAGG + Intronic
937749421 2:125456741-125456763 CTGTGACCATAGCTGCAGCCTGG - Intergenic
938841411 2:135168541-135168563 GTGGAGTCATAGCTGCAGCCTGG - Exonic
940560159 2:155284849-155284871 TTGTATCCATTCCTGGAGCCTGG + Intergenic
941319680 2:164039435-164039457 TTTTAGCCATGGCTGGATCCAGG - Intergenic
944644388 2:201763549-201763571 TTGTAGCCACAGCTAGAGCCTGG - Intronic
946488022 2:220119663-220119685 TTGTTGTCACAGCTGGAGACAGG + Intergenic
948466825 2:238156266-238156288 CTTGAGCCATAGCTGCAGCCAGG + Intergenic
948991159 2:241554770-241554792 TTTCAGGCATAGCTGGATCCAGG - Intergenic
1171963048 20:31509071-31509093 TTGCAGCCCCTGCTGGAGCCTGG - Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172906217 20:38371657-38371679 TTTCAGGCATAGCTGGATCCAGG + Intronic
1173314542 20:41931441-41931463 TTTGAGCCACAGCTGGAGCTGGG + Intergenic
1176093273 20:63328387-63328409 TTGGAGCAGAAGCTGGAGCCGGG + Exonic
1179034710 21:37749500-37749522 TTGCACCCATACCTGGAGCCCGG + Intronic
1179770914 21:43616101-43616123 TGGTAGCCATCTCTGGAGTCAGG - Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181981375 22:26769232-26769254 TTGTACCCACAGCCAGAGCCGGG + Intergenic
1184499913 22:44865417-44865439 TTGGACCCATTGCTGCAGCCAGG + Intergenic
1184630801 22:45777269-45777291 TTGTTACCATAGCTGGAGTCGGG + Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
950261187 3:11544292-11544314 TTGCAGCCATACCTGGGCCCTGG - Intronic
954759983 3:52867019-52867041 TGGTAGCCAGGGCTGCAGCCGGG - Intronic
954796711 3:53165162-53165184 TTGTAGCAGCAGCGGGAGCCAGG + Intronic
955538633 3:59951318-59951340 TTGTAGCCATTGCTGTTGACTGG + Intronic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
959005539 3:101015430-101015452 TGGTAGCAATAGGTGGATCCAGG + Intergenic
960798784 3:121516298-121516320 TTGTAGCCATTGCAAGAGTCAGG - Intronic
961278710 3:125747914-125747936 TTGGTGACATAGCTGAAGCCAGG - Intergenic
963606210 3:147413390-147413412 TCGTAGCCAGAGCTGGCGGCCGG - Exonic
964523714 3:157594846-157594868 TTGTAACCACAGTTGGAGGCAGG + Intronic
964612165 3:158626767-158626789 TTGGAGCCATGGCTGAGGCCTGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970722216 4:19001119-19001141 TTGTAGGCTTAGATGAAGCCTGG + Intergenic
970886368 4:20991788-20991810 TTGTAGCCATGGCTGGGGCTTGG + Intronic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
973296100 4:48522317-48522339 GTGTAACCATAGCTGGTGCCTGG + Intronic
973317976 4:48780794-48780816 ATGTATCCAGAGCTGGCGCCCGG + Intergenic
974878501 4:67725348-67725370 CTGCAGTCATAGCTGAAGCCTGG - Intergenic
975344810 4:73281782-73281804 CTGTAGCCAGAGCTTGAGCAGGG - Intergenic
975882389 4:78925978-78926000 TTGTATTGGTAGCTGGAGCCAGG - Intronic
976000799 4:80371166-80371188 TTTGAGCCACAGCTGGAGCTGGG + Intronic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
983989576 4:174101347-174101369 TGGGAGCCAGAGCTAGAGCCTGG - Intergenic
984998225 4:185457477-185457499 TTGTTACAATAGCAGGAGCCAGG - Intronic
985561329 5:587675-587697 TTGTGGCCAGAGCTGGAGCCGGG - Intergenic
985964133 5:3326697-3326719 ATTAAGCCATATCTGGAGCCTGG - Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
986589069 5:9350036-9350058 TTGAAGCCATACCTGGAGAGTGG + Intronic
987675025 5:21063399-21063421 TTTTAGCCATAGCCGGAGCTGGG - Intergenic
989434657 5:41397297-41397319 TTGTAACCATGGCTAGAGCTGGG - Intronic
991324570 5:65416195-65416217 TTGTAGTCACAGCTGGAGCCTGG - Intronic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
993970886 5:94418817-94418839 ATGTAGGCATTGCTGGATCCAGG - Intronic
995732846 5:115264653-115264675 TTGTAGCCACCGCTGGAGCCTGG + Intergenic
996096931 5:119408745-119408767 TTGTATTAATAGCTGGAGCTTGG + Intergenic
996142743 5:119932715-119932737 CAGCAGCCTTAGCTGGAGCCAGG - Intergenic
997737923 5:136228162-136228184 TTGTACCCAGAGCTGGAGGAGGG + Intronic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
999667203 5:153925316-153925338 CTTTAGGCATAGCTGGATCCAGG - Intergenic
1001226566 5:169949494-169949516 TTGTAAAAGTAGCTGGAGCCTGG + Intronic
1001648661 5:173300072-173300094 TTTCAGGCATAGCTGGACCCAGG - Intergenic
1002444357 5:179280026-179280048 TTGGAGCTATGGCTGGAGCTGGG + Intronic
1002487647 5:179550615-179550637 CTGGAGCCGGAGCTGGAGCCGGG + Exonic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1010204079 6:73307709-73307731 TTTTAGCCAGAGCACGAGCCAGG - Intronic
1015759615 6:136644521-136644543 TTCTAGCCCTAACTGGGGCCTGG - Intronic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016745969 6:147580894-147580916 TTGGAGTCATAGCAGCAGCCAGG + Intronic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016840335 6:148518807-148518829 TTGAAGCCCTCACTGGAGCCAGG - Intronic
1017128019 6:151084082-151084104 ATGTAGCTATAGATGTAGCCAGG - Intronic
1017290252 6:152727506-152727528 TTGTAGCTATAGCTTGAGAGTGG + Intergenic
1019058088 6:169237092-169237114 GAGCAGCCACAGCTGGAGCCGGG - Intronic
1020508058 7:9018641-9018663 GTGCCGCCATAGCTGCAGCCTGG + Intergenic
1021719442 7:23491337-23491359 TTGTAGTCACAGCTGGAGCCTGG - Intergenic
1022979054 7:35586305-35586327 TATTAGTCATAGCTGGAGACGGG + Intergenic
1023606466 7:41935937-41935959 TTGAAGCCATTTCTGCAGCCTGG + Intergenic
1026863678 7:73809966-73809988 TTCTGGCCTTAGCTGGAGCTGGG - Intronic
1027395317 7:77747481-77747503 TTTGAGCCACAGCTGGAGCTGGG - Intronic
1031040773 7:116836462-116836484 TTGGAGTCAGAGCTGGAGCCAGG - Intronic
1031123720 7:117749373-117749395 TTGCAGCCATTGCTAGACCCAGG - Intronic
1031313208 7:120225667-120225689 TTGTAGACATAGTTGGACCTAGG - Intergenic
1031315864 7:120257013-120257035 TTTTAGCTATGGCTGGAGCTGGG - Intergenic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1034502027 7:151456837-151456859 TTTGAGCCAAAGCTGGAGCTGGG + Intergenic
1036137611 8:6176160-6176182 TTGCAGCCTCTGCTGGAGCCGGG - Intergenic
1036598209 8:10233186-10233208 TTGTAGCCACTGCTGCAGCAGGG + Intronic
1036920214 8:12845482-12845504 TGGTAGCCACAGCTGGAGCCTGG + Intergenic
1037019091 8:13945921-13945943 CTGTAGCCATAGAAGGAGACAGG - Intergenic
1039778998 8:40765157-40765179 TTGAAGCCATTGCTGGGTCCGGG - Intronic
1041532372 8:58884060-58884082 TTGAAGCCTCAGCTGGACCCTGG - Intronic
1043380270 8:79695123-79695145 TTGCAGCCCGAGCTGCAGCCTGG - Intergenic
1044847179 8:96393307-96393329 TATTAGCCAAAGCTGGAGGCTGG - Intergenic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1047903304 8:129446853-129446875 TTCTAGACATAGCTGGATCCAGG + Intergenic
1048859629 8:138714498-138714520 TGGCAGCCATAGAAGGAGCCTGG - Intronic
1051437348 9:17047231-17047253 TTTCAGGCATAGCTGGATCCAGG + Intergenic
1051606320 9:18920783-18920805 CTTTAGGCATAGCTGGAACCAGG - Intergenic
1052285935 9:26785877-26785899 TGGGAGCCATGGCTGGAGCAGGG - Intergenic
1054458722 9:65450458-65450480 CTGGAGCCAGGGCTGGAGCCAGG + Intergenic
1054968496 9:71057295-71057317 TTGTAGCCCTAGCTTGGGCTTGG + Intronic
1055993433 9:82131605-82131627 TTGTAGCCATAGCTGGAGCCTGG - Intergenic
1056179012 9:84063519-84063541 TTGAAGACATACCTGGTGCCTGG - Intergenic
1056442662 9:86636220-86636242 TTCCAGCCATAGCAGGTGCCTGG - Intergenic
1056770806 9:89476770-89476792 TTGGAGGCATCTCTGGAGCCTGG - Intronic
1056949443 9:91030289-91030311 TAGTATCAATAGCTGGAGCTTGG - Intergenic
1058885278 9:109318339-109318361 GTGTAGCCCTCACTGGAGCCTGG - Intronic
1060839260 9:126781367-126781389 TTGTAGCCCTGCCTGGACCCAGG - Intergenic
1187209674 X:17217123-17217145 TTGTTGCCATAACTGGAGGAGGG - Intergenic
1187972499 X:24672991-24673013 TTGTTGCCATAGCTTCAGCGAGG - Intergenic
1188106823 X:26156442-26156464 TTTTAGCCATGACTGGAGCAGGG + Intergenic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1191979382 X:66909237-66909259 TAGTAGCAATGGCTGGAGCTGGG + Intergenic
1199329570 X:146543088-146543110 TTTGAGCCATGGCTGGAGCTGGG + Intergenic
1199357155 X:146875689-146875711 TTTTAGCCATGGCTTGAGCCTGG - Intergenic
1200281185 X:154778343-154778365 CTGTAGCCATATCATGAGCCAGG + Intergenic