ID: 1055994103

View in Genome Browser
Species Human (GRCh38)
Location 9:82138980-82139002
Sequence GACAAGTTAGATTATTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055994103_1055994108 28 Left 1055994103 9:82138980-82139002 CCTTTTAAATAATCTAACTTGTC No data
Right 1055994108 9:82139031-82139053 TCTGTGTTTAGTCGTGTCTCTGG No data
1055994103_1055994106 4 Left 1055994103 9:82138980-82139002 CCTTTTAAATAATCTAACTTGTC No data
Right 1055994106 9:82139007-82139029 GACAGTGATGTTCTCAGGGCAGG No data
1055994103_1055994104 -1 Left 1055994103 9:82138980-82139002 CCTTTTAAATAATCTAACTTGTC No data
Right 1055994104 9:82139002-82139024 CATATGACAGTGATGTTCTCAGG No data
1055994103_1055994107 5 Left 1055994103 9:82138980-82139002 CCTTTTAAATAATCTAACTTGTC No data
Right 1055994107 9:82139008-82139030 ACAGTGATGTTCTCAGGGCAGGG No data
1055994103_1055994105 0 Left 1055994103 9:82138980-82139002 CCTTTTAAATAATCTAACTTGTC No data
Right 1055994105 9:82139003-82139025 ATATGACAGTGATGTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055994103 Original CRISPR GACAAGTTAGATTATTTAAA AGG (reversed) Intergenic
No off target data available for this crispr