ID: 1055994105

View in Genome Browser
Species Human (GRCh38)
Location 9:82139003-82139025
Sequence ATATGACAGTGATGTTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055994103_1055994105 0 Left 1055994103 9:82138980-82139002 CCTTTTAAATAATCTAACTTGTC No data
Right 1055994105 9:82139003-82139025 ATATGACAGTGATGTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055994105 Original CRISPR ATATGACAGTGATGTTCTCA GGG Intergenic
No off target data available for this crispr