ID: 1055994106

View in Genome Browser
Species Human (GRCh38)
Location 9:82139007-82139029
Sequence GACAGTGATGTTCTCAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055994103_1055994106 4 Left 1055994103 9:82138980-82139002 CCTTTTAAATAATCTAACTTGTC No data
Right 1055994106 9:82139007-82139029 GACAGTGATGTTCTCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055994106 Original CRISPR GACAGTGATGTTCTCAGGGC AGG Intergenic
No off target data available for this crispr