ID: 1055994108

View in Genome Browser
Species Human (GRCh38)
Location 9:82139031-82139053
Sequence TCTGTGTTTAGTCGTGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055994103_1055994108 28 Left 1055994103 9:82138980-82139002 CCTTTTAAATAATCTAACTTGTC No data
Right 1055994108 9:82139031-82139053 TCTGTGTTTAGTCGTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055994108 Original CRISPR TCTGTGTTTAGTCGTGTCTC TGG Intergenic
No off target data available for this crispr