ID: 1055994489

View in Genome Browser
Species Human (GRCh38)
Location 9:82142533-82142555
Sequence GTGTTCTAAAAGAAGTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055994489_1055994492 2 Left 1055994489 9:82142533-82142555 CCCACAGACTTCTTTTAGAACAC No data
Right 1055994492 9:82142558-82142580 TTCTAGAAAAGGTAAGAGTCTGG No data
1055994489_1055994491 -9 Left 1055994489 9:82142533-82142555 CCCACAGACTTCTTTTAGAACAC No data
Right 1055994491 9:82142547-82142569 TTAGAACACACTTCTAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055994489 Original CRISPR GTGTTCTAAAAGAAGTCTGT GGG (reversed) Intergenic
No off target data available for this crispr