ID: 1055995648

View in Genome Browser
Species Human (GRCh38)
Location 9:82156688-82156710
Sequence CATTTCCACAGAAGATTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055995648_1055995661 30 Left 1055995648 9:82156688-82156710 CCTGCAAATCTTCTGTGGAAATG No data
Right 1055995661 9:82156741-82156763 AGGAGGTGTTTGGGTCATGGGGG 0: 60
1: 598
2: 1692
3: 4620
4: 8299
1055995648_1055995651 1 Left 1055995648 9:82156688-82156710 CCTGCAAATCTTCTGTGGAAATG No data
Right 1055995651 9:82156712-82156734 GATCCCTAATGTTGGAGATAGGG No data
1055995648_1055995660 29 Left 1055995648 9:82156688-82156710 CCTGCAAATCTTCTGTGGAAATG No data
Right 1055995660 9:82156740-82156762 TAGGAGGTGTTTGGGTCATGGGG 0: 64
1: 707
2: 2152
3: 5875
4: 9329
1055995648_1055995657 21 Left 1055995648 9:82156688-82156710 CCTGCAAATCTTCTGTGGAAATG No data
Right 1055995657 9:82156732-82156754 GGGACTAATAGGAGGTGTTTGGG No data
1055995648_1055995649 -7 Left 1055995648 9:82156688-82156710 CCTGCAAATCTTCTGTGGAAATG No data
Right 1055995649 9:82156704-82156726 GGAAATGTGATCCCTAATGTTGG No data
1055995648_1055995655 13 Left 1055995648 9:82156688-82156710 CCTGCAAATCTTCTGTGGAAATG No data
Right 1055995655 9:82156724-82156746 TGGAGATAGGGACTAATAGGAGG No data
1055995648_1055995650 0 Left 1055995648 9:82156688-82156710 CCTGCAAATCTTCTGTGGAAATG No data
Right 1055995650 9:82156711-82156733 TGATCCCTAATGTTGGAGATAGG 0: 5
1: 54
2: 496
3: 1981
4: 3953
1055995648_1055995654 10 Left 1055995648 9:82156688-82156710 CCTGCAAATCTTCTGTGGAAATG No data
Right 1055995654 9:82156721-82156743 TGTTGGAGATAGGGACTAATAGG No data
1055995648_1055995656 20 Left 1055995648 9:82156688-82156710 CCTGCAAATCTTCTGTGGAAATG No data
Right 1055995656 9:82156731-82156753 AGGGACTAATAGGAGGTGTTTGG No data
1055995648_1055995658 27 Left 1055995648 9:82156688-82156710 CCTGCAAATCTTCTGTGGAAATG No data
Right 1055995658 9:82156738-82156760 AATAGGAGGTGTTTGGGTCATGG 0: 18
1: 197
2: 727
3: 1536
4: 3092
1055995648_1055995659 28 Left 1055995648 9:82156688-82156710 CCTGCAAATCTTCTGTGGAAATG No data
Right 1055995659 9:82156739-82156761 ATAGGAGGTGTTTGGGTCATGGG 0: 18
1: 255
2: 1052
3: 2358
4: 5404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055995648 Original CRISPR CATTTCCACAGAAGATTTGC AGG (reversed) Intergenic
No off target data available for this crispr