ID: 1056009635

View in Genome Browser
Species Human (GRCh38)
Location 9:82313694-82313716
Sequence ATGTGCATAAGGAGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056009628_1056009635 28 Left 1056009628 9:82313643-82313665 CCATTACTACTAGGACATCCAGG No data
Right 1056009635 9:82313694-82313716 ATGTGCATAAGGAGGGAGCAGGG No data
1056009630_1056009635 10 Left 1056009630 9:82313661-82313683 CCAGGTAGATAATCAAAGTCATT No data
Right 1056009635 9:82313694-82313716 ATGTGCATAAGGAGGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056009635 Original CRISPR ATGTGCATAAGGAGGGAGCA GGG Intergenic
No off target data available for this crispr