ID: 1056011537

View in Genome Browser
Species Human (GRCh38)
Location 9:82335990-82336012
Sequence GTTCTATCCTGTGTTAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056011531_1056011537 -4 Left 1056011531 9:82335971-82335993 CCAGTACTTCCCCAAGTGTGTTC No data
Right 1056011537 9:82335990-82336012 GTTCTATCCTGTGTTAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056011537 Original CRISPR GTTCTATCCTGTGTTAAAAG GGG Intergenic
No off target data available for this crispr