ID: 1056013322

View in Genome Browser
Species Human (GRCh38)
Location 9:82355422-82355444
Sequence GGTGGTGAATGATACTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056013316_1056013322 4 Left 1056013316 9:82355395-82355417 CCAAAGGAAATAATGACTATAGC No data
Right 1056013322 9:82355422-82355444 GGTGGTGAATGATACTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056013322 Original CRISPR GGTGGTGAATGATACTTTGG GGG Intergenic
No off target data available for this crispr