ID: 1056015600

View in Genome Browser
Species Human (GRCh38)
Location 9:82383038-82383060
Sequence TTATGAGATTCCTAAGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056015595_1056015600 13 Left 1056015595 9:82383002-82383024 CCTGTCTTTTTCAGTGGTTAGTC No data
Right 1056015600 9:82383038-82383060 TTATGAGATTCCTAAGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056015600 Original CRISPR TTATGAGATTCCTAAGGAGG GGG Intergenic
No off target data available for this crispr