ID: 1056019096

View in Genome Browser
Species Human (GRCh38)
Location 9:82423066-82423088
Sequence CTGAGTTTGCAAATCTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056019093_1056019096 -4 Left 1056019093 9:82423047-82423069 CCCAGGGGCACTATTAAACCTGA No data
Right 1056019096 9:82423066-82423088 CTGAGTTTGCAAATCTATCTTGG No data
1056019094_1056019096 -5 Left 1056019094 9:82423048-82423070 CCAGGGGCACTATTAAACCTGAG No data
Right 1056019096 9:82423066-82423088 CTGAGTTTGCAAATCTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056019096 Original CRISPR CTGAGTTTGCAAATCTATCT TGG Intergenic
No off target data available for this crispr