ID: 1056019096 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:82423066-82423088 |
| Sequence | CTGAGTTTGCAAATCTATCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1056019093_1056019096 | -4 | Left | 1056019093 | 9:82423047-82423069 | CCCAGGGGCACTATTAAACCTGA | No data | ||
| Right | 1056019096 | 9:82423066-82423088 | CTGAGTTTGCAAATCTATCTTGG | No data | ||||
| 1056019094_1056019096 | -5 | Left | 1056019094 | 9:82423048-82423070 | CCAGGGGCACTATTAAACCTGAG | No data | ||
| Right | 1056019096 | 9:82423066-82423088 | CTGAGTTTGCAAATCTATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1056019096 | Original CRISPR | CTGAGTTTGCAAATCTATCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||