ID: 1056019416

View in Genome Browser
Species Human (GRCh38)
Location 9:82425840-82425862
Sequence GAATGCCCACGTAATAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056019416_1056019421 25 Left 1056019416 9:82425840-82425862 CCTACTTTATTACGTGGGCATTC No data
Right 1056019421 9:82425888-82425910 TAGCCCTATGACAAGGTTTAGGG No data
1056019416_1056019422 26 Left 1056019416 9:82425840-82425862 CCTACTTTATTACGTGGGCATTC No data
Right 1056019422 9:82425889-82425911 AGCCCTATGACAAGGTTTAGGGG No data
1056019416_1056019418 -10 Left 1056019416 9:82425840-82425862 CCTACTTTATTACGTGGGCATTC No data
Right 1056019418 9:82425853-82425875 GTGGGCATTCTTTATTAGTAGGG No data
1056019416_1056019419 18 Left 1056019416 9:82425840-82425862 CCTACTTTATTACGTGGGCATTC No data
Right 1056019419 9:82425881-82425903 AATGTGATAGCCCTATGACAAGG No data
1056019416_1056019420 24 Left 1056019416 9:82425840-82425862 CCTACTTTATTACGTGGGCATTC No data
Right 1056019420 9:82425887-82425909 ATAGCCCTATGACAAGGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056019416 Original CRISPR GAATGCCCACGTAATAAAGT AGG (reversed) Intergenic
No off target data available for this crispr