ID: 1056020279

View in Genome Browser
Species Human (GRCh38)
Location 9:82432578-82432600
Sequence GGCTGCTTCCCCATTGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056020273_1056020279 5 Left 1056020273 9:82432550-82432572 CCTGAGTCTCCAGGGGCCTAGAG 0: 10
1: 1
2: 3
3: 22
4: 203
Right 1056020279 9:82432578-82432600 GGCTGCTTCCCCATTGCTACAGG No data
1056020277_1056020279 -4 Left 1056020277 9:82432559-82432581 CCAGGGGCCTAGAGGTGGAGGCT 0: 7
1: 3
2: 10
3: 72
4: 972
Right 1056020279 9:82432578-82432600 GGCTGCTTCCCCATTGCTACAGG No data
1056020272_1056020279 6 Left 1056020272 9:82432549-82432571 CCCTGAGTCTCCAGGGGCCTAGA 0: 10
1: 1
2: 7
3: 21
4: 179
Right 1056020279 9:82432578-82432600 GGCTGCTTCCCCATTGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056020279 Original CRISPR GGCTGCTTCCCCATTGCTAC AGG Intergenic
No off target data available for this crispr