ID: 1056020982

View in Genome Browser
Species Human (GRCh38)
Location 9:82438086-82438108
Sequence CAGGCTGCTGCACTTGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056020982_1056020988 -3 Left 1056020982 9:82438086-82438108 CCTCCAGCAAGTGCAGCAGCCTG No data
Right 1056020988 9:82438106-82438128 CTGGTGCAGACCTTGGGCTGTGG 0: 2
1: 0
2: 2
3: 31
4: 331
1056020982_1056020986 -9 Left 1056020982 9:82438086-82438108 CCTCCAGCAAGTGCAGCAGCCTG No data
Right 1056020986 9:82438100-82438122 AGCAGCCTGGTGCAGACCTTGGG 0: 2
1: 0
2: 2
3: 13
4: 172
1056020982_1056020991 24 Left 1056020982 9:82438086-82438108 CCTCCAGCAAGTGCAGCAGCCTG No data
Right 1056020991 9:82438133-82438155 GATCCCTGAGTGCCCCTAACAGG No data
1056020982_1056020985 -10 Left 1056020982 9:82438086-82438108 CCTCCAGCAAGTGCAGCAGCCTG No data
Right 1056020985 9:82438099-82438121 CAGCAGCCTGGTGCAGACCTTGG 0: 2
1: 0
2: 1
3: 29
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056020982 Original CRISPR CAGGCTGCTGCACTTGCTGG AGG (reversed) Intergenic
No off target data available for this crispr