ID: 1056035437

View in Genome Browser
Species Human (GRCh38)
Location 9:82600200-82600222
Sequence TTAAGGTTCTTATTCTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056035437_1056035443 10 Left 1056035437 9:82600200-82600222 CCTGGACAGAATAAGAACCTTAA No data
Right 1056035443 9:82600233-82600255 CCCGTGTGCTTTTCAGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056035437 Original CRISPR TTAAGGTTCTTATTCTGTCC AGG (reversed) Intergenic
No off target data available for this crispr