ID: 1056039151

View in Genome Browser
Species Human (GRCh38)
Location 9:82643107-82643129
Sequence ACTAATATCCAGAATGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056039150_1056039151 24 Left 1056039150 9:82643060-82643082 CCTGTTGAAAGAGAGAAAATATT No data
Right 1056039151 9:82643107-82643129 ACTAATATCCAGAATGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056039151 Original CRISPR ACTAATATCCAGAATGTAGA AGG Intergenic
No off target data available for this crispr