ID: 1056040252

View in Genome Browser
Species Human (GRCh38)
Location 9:82658489-82658511
Sequence CTGAGAGAAAAGAAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056040246_1056040252 18 Left 1056040246 9:82658448-82658470 CCCATGACTGCTGCTTTATAAGC No data
Right 1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG No data
1056040248_1056040252 -9 Left 1056040248 9:82658475-82658497 CCAACTCACCAGTTCTGAGAGAA No data
Right 1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG No data
1056040247_1056040252 17 Left 1056040247 9:82658449-82658471 CCATGACTGCTGCTTTATAAGCA No data
Right 1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056040252 Original CRISPR CTGAGAGAAAAGAAGGAAGG TGG Intergenic
No off target data available for this crispr