ID: 1056040306

View in Genome Browser
Species Human (GRCh38)
Location 9:82658895-82658917
Sequence GGGCATAGTGGCGCACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056040306_1056040311 7 Left 1056040306 9:82658895-82658917 CCATGGTGTGCGCCACTATGCCC No data
Right 1056040311 9:82658925-82658947 ACTTGTATTTTTTGTAAAGACGG No data
1056040306_1056040313 9 Left 1056040306 9:82658895-82658917 CCATGGTGTGCGCCACTATGCCC No data
Right 1056040313 9:82658927-82658949 TTGTATTTTTTGTAAAGACGGGG 0: 78
1: 4547
2: 120814
3: 242458
4: 157686
1056040306_1056040312 8 Left 1056040306 9:82658895-82658917 CCATGGTGTGCGCCACTATGCCC No data
Right 1056040312 9:82658926-82658948 CTTGTATTTTTTGTAAAGACGGG 0: 5
1: 305
2: 11479
3: 197507
4: 227650
1056040306_1056040314 28 Left 1056040306 9:82658895-82658917 CCATGGTGTGCGCCACTATGCCC No data
Right 1056040314 9:82658946-82658968 GGGGTTTCACCATTTTGCCCAGG 0: 88
1: 7187
2: 98812
3: 189074
4: 224300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056040306 Original CRISPR GGGCATAGTGGCGCACACCA TGG (reversed) Intergenic
No off target data available for this crispr