ID: 1056045795

View in Genome Browser
Species Human (GRCh38)
Location 9:82714231-82714253
Sequence AAGCTCCATTATTGCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056045792_1056045795 13 Left 1056045792 9:82714195-82714217 CCATGCTCATGGCAAAAGTAAAA No data
Right 1056045795 9:82714231-82714253 AAGCTCCATTATTGCAAAGCAGG No data
1056045790_1056045795 30 Left 1056045790 9:82714178-82714200 CCTGACAAAGCTTAACACCATGC No data
Right 1056045795 9:82714231-82714253 AAGCTCCATTATTGCAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056045795 Original CRISPR AAGCTCCATTATTGCAAAGC AGG Intergenic
No off target data available for this crispr