ID: 1056050045

View in Genome Browser
Species Human (GRCh38)
Location 9:82758751-82758773
Sequence GTACCCTAAATCACTTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056050045_1056050051 -9 Left 1056050045 9:82758751-82758773 CCTCCTTAAGTGATTTAGGGTAC No data
Right 1056050051 9:82758765-82758787 TTAGGGTACGGTTGGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056050045 Original CRISPR GTACCCTAAATCACTTAAGG AGG (reversed) Intergenic
No off target data available for this crispr