ID: 1056052492

View in Genome Browser
Species Human (GRCh38)
Location 9:82784042-82784064
Sequence AAAAAGCGACAGAGGGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056052492_1056052497 13 Left 1056052492 9:82784042-82784064 CCGTGCTCCCTCTGTCGCTTTTT No data
Right 1056052497 9:82784078-82784100 TCTTTGTGTCTTCGAGCTTCTGG No data
1056052492_1056052498 16 Left 1056052492 9:82784042-82784064 CCGTGCTCCCTCTGTCGCTTTTT No data
Right 1056052498 9:82784081-82784103 TTGTGTCTTCGAGCTTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056052492 Original CRISPR AAAAAGCGACAGAGGGAGCA CGG (reversed) Intergenic
No off target data available for this crispr