ID: 1056054377

View in Genome Browser
Species Human (GRCh38)
Location 9:82805821-82805843
Sequence TTAGGGAGCCTGGAAAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056054373_1056054377 7 Left 1056054373 9:82805791-82805813 CCAATTTGTTTCATTGGTGAATA No data
Right 1056054377 9:82805821-82805843 TTAGGGAGCCTGGAAAAAAATGG No data
1056054372_1056054377 8 Left 1056054372 9:82805790-82805812 CCCAATTTGTTTCATTGGTGAAT No data
Right 1056054377 9:82805821-82805843 TTAGGGAGCCTGGAAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056054377 Original CRISPR TTAGGGAGCCTGGAAAAAAA TGG Intergenic
No off target data available for this crispr