ID: 1056054859

View in Genome Browser
Species Human (GRCh38)
Location 9:82811030-82811052
Sequence CTCCATCTTGATTAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056054855_1056054859 9 Left 1056054855 9:82810998-82811020 CCAAAATGTCAGAGGCATGTGAA No data
Right 1056054859 9:82811030-82811052 CTCCATCTTGATTAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056054859 Original CRISPR CTCCATCTTGATTAGGAGCT GGG Intergenic
No off target data available for this crispr