ID: 1056057633

View in Genome Browser
Species Human (GRCh38)
Location 9:82844029-82844051
Sequence CCAAATCTTGCATGTATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056057633_1056057641 8 Left 1056057633 9:82844029-82844051 CCCAAAATACATGCAAGATTTGG No data
Right 1056057641 9:82844060-82844082 GGATAAGAAGGGCAATTCTGAGG No data
1056057633_1056057638 -4 Left 1056057633 9:82844029-82844051 CCCAAAATACATGCAAGATTTGG No data
Right 1056057638 9:82844048-82844070 TTGGCCACACAGGGATAAGAAGG No data
1056057633_1056057642 14 Left 1056057633 9:82844029-82844051 CCCAAAATACATGCAAGATTTGG No data
Right 1056057642 9:82844066-82844088 GAAGGGCAATTCTGAGGAAAAGG No data
1056057633_1056057639 -3 Left 1056057633 9:82844029-82844051 CCCAAAATACATGCAAGATTTGG No data
Right 1056057639 9:82844049-82844071 TGGCCACACAGGGATAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056057633 Original CRISPR CCAAATCTTGCATGTATTTT GGG (reversed) Intergenic
No off target data available for this crispr