ID: 1056058259

View in Genome Browser
Species Human (GRCh38)
Location 9:82852232-82852254
Sequence AGCTACAGAGCTTCATACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056058259_1056058261 24 Left 1056058259 9:82852232-82852254 CCATAGTATGAAGCTCTGTAGCT No data
Right 1056058261 9:82852279-82852301 TAACTGAAAAGCCAGAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056058259 Original CRISPR AGCTACAGAGCTTCATACTA TGG (reversed) Intergenic
No off target data available for this crispr