ID: 1056061175

View in Genome Browser
Species Human (GRCh38)
Location 9:82886090-82886112
Sequence GGGGTCACACAGATGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056061175_1056061183 7 Left 1056061175 9:82886090-82886112 CCATGTCCCATCTGTGTGACCCC No data
Right 1056061183 9:82886120-82886142 ATTGGACCGTTCAACTCACCTGG No data
1056061175_1056061186 29 Left 1056061175 9:82886090-82886112 CCATGTCCCATCTGTGTGACCCC No data
Right 1056061186 9:82886142-82886164 GCAGCCACTCCCAGAGCCCCTGG 0: 499
1: 274
2: 95
3: 106
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056061175 Original CRISPR GGGGTCACACAGATGGGACA TGG (reversed) Intergenic
No off target data available for this crispr