ID: 1056061183

View in Genome Browser
Species Human (GRCh38)
Location 9:82886120-82886142
Sequence ATTGGACCGTTCAACTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056061173_1056061183 16 Left 1056061173 9:82886081-82886103 CCTCCTAAGCCATGTCCCATCTG 0: 173
1: 308
2: 297
3: 177
4: 273
Right 1056061183 9:82886120-82886142 ATTGGACCGTTCAACTCACCTGG No data
1056061178_1056061183 0 Left 1056061178 9:82886097-82886119 CCATCTGTGTGACCCCACTGGAA No data
Right 1056061183 9:82886120-82886142 ATTGGACCGTTCAACTCACCTGG No data
1056061174_1056061183 13 Left 1056061174 9:82886084-82886106 CCTAAGCCATGTCCCATCTGTGT 0: 54
1: 255
2: 334
3: 249
4: 303
Right 1056061183 9:82886120-82886142 ATTGGACCGTTCAACTCACCTGG No data
1056061172_1056061183 24 Left 1056061172 9:82886073-82886095 CCAGGATTCCTCCTAAGCCATGT 0: 135
1: 279
2: 291
3: 124
4: 193
Right 1056061183 9:82886120-82886142 ATTGGACCGTTCAACTCACCTGG No data
1056061171_1056061183 25 Left 1056061171 9:82886072-82886094 CCCAGGATTCCTCCTAAGCCATG 0: 93
1: 298
2: 309
3: 237
4: 232
Right 1056061183 9:82886120-82886142 ATTGGACCGTTCAACTCACCTGG No data
1056061177_1056061183 1 Left 1056061177 9:82886096-82886118 CCCATCTGTGTGACCCCACTGGA No data
Right 1056061183 9:82886120-82886142 ATTGGACCGTTCAACTCACCTGG No data
1056061175_1056061183 7 Left 1056061175 9:82886090-82886112 CCATGTCCCATCTGTGTGACCCC No data
Right 1056061183 9:82886120-82886142 ATTGGACCGTTCAACTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056061183 Original CRISPR ATTGGACCGTTCAACTCACC TGG Intergenic
No off target data available for this crispr