ID: 1056061186

View in Genome Browser
Species Human (GRCh38)
Location 9:82886142-82886164
Sequence GCAGCCACTCCCAGAGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1530
Summary {0: 499, 1: 274, 2: 95, 3: 106, 4: 556}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056061177_1056061186 23 Left 1056061177 9:82886096-82886118 CCCATCTGTGTGACCCCACTGGA No data
Right 1056061186 9:82886142-82886164 GCAGCCACTCCCAGAGCCCCTGG 0: 499
1: 274
2: 95
3: 106
4: 556
1056061181_1056061186 9 Left 1056061181 9:82886110-82886132 CCCACTGGAAATTGGACCGTTCA No data
Right 1056061186 9:82886142-82886164 GCAGCCACTCCCAGAGCCCCTGG 0: 499
1: 274
2: 95
3: 106
4: 556
1056061175_1056061186 29 Left 1056061175 9:82886090-82886112 CCATGTCCCATCTGTGTGACCCC No data
Right 1056061186 9:82886142-82886164 GCAGCCACTCCCAGAGCCCCTGG 0: 499
1: 274
2: 95
3: 106
4: 556
1056061180_1056061186 10 Left 1056061180 9:82886109-82886131 CCCCACTGGAAATTGGACCGTTC No data
Right 1056061186 9:82886142-82886164 GCAGCCACTCCCAGAGCCCCTGG 0: 499
1: 274
2: 95
3: 106
4: 556
1056061182_1056061186 8 Left 1056061182 9:82886111-82886133 CCACTGGAAATTGGACCGTTCAA No data
Right 1056061186 9:82886142-82886164 GCAGCCACTCCCAGAGCCCCTGG 0: 499
1: 274
2: 95
3: 106
4: 556
1056061178_1056061186 22 Left 1056061178 9:82886097-82886119 CCATCTGTGTGACCCCACTGGAA No data
Right 1056061186 9:82886142-82886164 GCAGCCACTCCCAGAGCCCCTGG 0: 499
1: 274
2: 95
3: 106
4: 556
1056061184_1056061186 -7 Left 1056061184 9:82886126-82886148 CCGTTCAACTCACCTGGCAGCCA No data
Right 1056061186 9:82886142-82886164 GCAGCCACTCCCAGAGCCCCTGG 0: 499
1: 274
2: 95
3: 106
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056061186 Original CRISPR GCAGCCACTCCCAGAGCCCC TGG Intergenic
900171663 1:1272371-1272393 GCAGCCACTGCCTCAGCACCTGG - Intronic
900482067 1:2904241-2904263 GCAGCCCCTCCCTGAGCCTCTGG - Intergenic
900589628 1:3453941-3453963 CCAGCCCCTCCCACAGCACCAGG + Intergenic
900619738 1:3581280-3581302 ACAGCCACTACCATTGCCCCAGG + Intronic
900649150 1:3722558-3722580 GCAGGCACCCCCAGAGCACAAGG + Intronic
900712392 1:4122633-4122655 CCAGCAGCTGCCAGAGCCCCGGG + Intergenic
900722510 1:4186554-4186576 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
900833424 1:4981274-4981296 ACAGCACCTCCCAGAACCCCTGG + Intergenic
900840821 1:5047236-5047258 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
900847510 1:5115511-5115533 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
901500820 1:9651853-9651875 GCCGCAGCTCCCAAAGCCCCTGG - Intronic
901529213 1:9843077-9843099 GCAGCTCCTCCCAGCGCCTCCGG - Intergenic
901835823 1:11923368-11923390 TCAGCCCCTCCCTGAGCCACAGG - Exonic
902050951 1:13563269-13563291 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
902407000 1:16189877-16189899 GCAGCCCCGCCCACAGCCCGAGG + Intergenic
902482831 1:16720513-16720535 TCAGGCATTCCCTGAGCCCCTGG - Intergenic
902509539 1:16958690-16958712 GCAGCCTCTGCCGGAGGCCCAGG - Exonic
903001265 1:20267610-20267632 GAAGCCACTGCCAGAGACTCAGG - Intergenic
903185522 1:21626759-21626781 GCGGCTACTCCCAGAGGCTCAGG - Intronic
903395994 1:23002269-23002291 GCAGCCACTCCTGTAGCCCCTGG - Intergenic
903499129 1:23792099-23792121 CCATCCATTCCCAGACCCCCAGG - Intronic
903657988 1:24960591-24960613 GCACCCACTGCCAGTGTCCCTGG + Intronic
903663655 1:24994073-24994095 GCAGCAGGTCCCAGAGCCCCAGG - Intergenic
903683954 1:25117413-25117435 GCAGGCATTCCAAGAGGCCCTGG - Intergenic
903736033 1:25530412-25530434 CCAGCCATTCCCAGAGCCAGCGG + Intergenic
904393989 1:30205781-30205803 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
904469954 1:30730062-30730084 GCAGCCCCTCCCTGAACCTCAGG + Intergenic
904584446 1:31572147-31572169 GCAGCCATTCCCAGGGCCCAGGG - Intergenic
904711667 1:32434736-32434758 GCAGCCGCTCCCAGAGCCCCTGG + Intergenic
904827096 1:33280693-33280715 GCAGCCACCCCCACAGCCTGGGG + Intronic
904996450 1:34635279-34635301 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
905060489 1:35135652-35135674 TCAGCCACTCCCAGAGCCCCTGG - Intergenic
905183439 1:36179916-36179938 GCAGCCTCTCCCAGCACACCAGG + Exonic
905429320 1:37910040-37910062 GCAGCCACTCCCAGAGCCCCTGG + Intronic
905499811 1:38427470-38427492 GCAGCCACTCCCAGATCCCCTGG + Intergenic
906076945 1:43058820-43058842 GCAGCCTCTCCCATCTCCCCAGG + Intergenic
906080952 1:43087897-43087919 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
906378751 1:45318025-45318047 GCTGCCACTCCTAAAGCTCCTGG + Intergenic
906744489 1:48212300-48212322 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
907292662 1:53426685-53426707 ACAGCCACTCCCAGAGCTCCTGG + Intergenic
907293636 1:53434635-53434657 GCAGCCACTCCCACAGCCCCTGG + Intergenic
907503536 1:54901182-54901204 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
907521291 1:55024989-55025011 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
908460425 1:64343721-64343743 GCAGCTTTTCCCAGAGCCCCAGG + Intergenic
908461683 1:64353289-64353311 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
908591923 1:65645197-65645219 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
908852437 1:68388654-68388676 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
909014741 1:70369784-70369806 GCAGCCACTCCCAGAGCCCCTGG + Intronic
909035503 1:70590693-70590715 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
909222630 1:72983151-72983173 GCAGCCACTCCCAGAGCTCCTGG - Intergenic
909223621 1:72991105-72991127 GCAGCCACTCCCAGAGCTCCTGG - Intergenic
909550990 1:76898095-76898117 GCAGCCACTCCCAGAGCCCCTGG - Intronic
909776658 1:79491884-79491906 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
909788237 1:79642046-79642068 GCAACCACTCCCAGAGCCCCTGG - Intergenic
909792948 1:79699666-79699688 GCAGGCACTCCCAGAGCCCCTGG - Intergenic
909909992 1:81247828-81247850 GCAGCCATTCCCAGAGCCCCTGG + Intergenic
909978420 1:82070837-82070859 GCAGCCATTCCCAGAGCCCCTGG - Intergenic
910049415 1:82957704-82957726 GCAGCCACTACCAGAGCCCCTGG + Intergenic
910144101 1:84058544-84058566 GCAGCCACTCCCAGAGCCTGTGG - Intergenic
911071103 1:93832445-93832467 GCAGCCACTCCTAGAGCTCCTGG + Intronic
911147956 1:94570180-94570202 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
911510589 1:98804561-98804583 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
911570424 1:99512008-99512030 ACAGCCACTCCCAGAGCCCCTGG + Intergenic
911618244 1:100038182-100038204 GCAGCCACTCCCGGGGCGGCAGG - Exonic
911759750 1:101601356-101601378 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
911966955 1:104382576-104382598 ACAGTCACTCCCAGAGCCCCTGG + Intergenic
911983880 1:104598388-104598410 GCAGCCACTCCCAGAGCTCCTGG + Intergenic
912296503 1:108475340-108475362 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
912372870 1:109187297-109187319 GCTGCGACAGCCAGAGCCCCAGG - Intronic
912387299 1:109277915-109277937 GCAGCAACTCCCGCAGCCTCTGG - Intergenic
912813599 1:112811828-112811850 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
912815281 1:112823789-112823811 GCAGCCACTCTCAGAGCCCCTGG - Intergenic
913245160 1:116864487-116864509 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
913940806 1:125103112-125103134 AGAGCCACTCTCAGAGACCCTGG + Intergenic
913943914 1:125138879-125138901 AGAGCCACTCTCAGAGACCCTGG - Intergenic
913955284 1:143284875-143284897 AGAGCCACTCTCAGAGACCCTGG + Intergenic
913982151 1:143530569-143530591 AGAGCCACTCTCAGAGACCCTGG - Intergenic
914224287 1:145707581-145707603 CCAGCCACTCCCAGAGAACAAGG + Intronic
914244015 1:145872644-145872666 GCAGGCAGTCCCACAGCCCTCGG + Exonic
914335983 1:146715294-146715316 ACAGCCACACCCACAGCACCTGG + Intergenic
914903318 1:151724158-151724180 GCAGCCAGTCTCAGATACCCAGG - Intronic
915286640 1:154857471-154857493 CCAGCCTCCCCCAGAGCCTCAGG - Intronic
915907505 1:159889649-159889671 GCAGCCACTCCTGGAGCCAGAGG - Intronic
915913488 1:159928422-159928444 CCAGCCCCTACCACAGCCCCAGG + Exonic
915996254 1:160567327-160567349 GCAACCACTGAAAGAGCCCCAGG + Intronic
916183244 1:162106021-162106043 TCAGCCACACACAGAGACCCAGG - Intronic
916328890 1:163593410-163593432 GCAGCCTCTCCCAGAGCCCCTGG + Intergenic
916581851 1:166116146-166116168 GCAGCCCCACCAAGAGCCACAGG - Intronic
916941823 1:169685256-169685278 GCACCCACTCCCAGAGCCCCTGG + Intronic
917749688 1:178042366-178042388 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
917977959 1:180252132-180252154 GCAGGCTGCCCCAGAGCCCCAGG - Intronic
918347150 1:183616036-183616058 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
918567639 1:185951621-185951643 GCAGCCACTCCCAGAGCCCCTGG - Intronic
918714372 1:187768818-187768840 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
919476429 1:198037182-198037204 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
919788511 1:201275418-201275440 GCAGCCACACCCAGGGCAGCTGG - Intergenic
920041708 1:203102176-203102198 GCACCCACTCCCAGGGCTCCAGG - Intronic
920210138 1:204321929-204321951 GCATGCCCTGCCAGAGCCCCAGG - Intronic
920829433 1:209451324-209451346 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
920901496 1:210114134-210114156 GCAGCCACTCCCAGAGTCCCTGG - Intronic
921212452 1:212911894-212911916 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
921459749 1:215413265-215413287 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
921509290 1:216010395-216010417 GCAGCCACTCCCAGAGCCCCTGG + Intronic
921520163 1:216147936-216147958 GCAGCCACTCCCAGAGCCCCTGG + Intronic
921732940 1:218597114-218597136 GCAGCCACTCCCAGAGCCCTTGG - Intergenic
922048444 1:221968344-221968366 GCAGCCACTCCCAGAGCCCGTGG + Intergenic
922049500 1:221976428-221976450 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
922154033 1:223027728-223027750 GCAGCCACTCCCAGAGTCCCTGG - Intergenic
922363514 1:224843778-224843800 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
922514562 1:226197289-226197311 GCAGACCTGCCCAGAGCCCCAGG - Intergenic
922599006 1:226835655-226835677 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
922754869 1:228090196-228090218 GCAGGCACTCCCAGGGGCCTGGG - Intronic
922811126 1:228416313-228416335 GCAGCCAGAGCCAGAGCCCCAGG - Intronic
922814239 1:228438013-228438035 GTAGCCACTCACAGACCCACAGG - Intergenic
922877115 1:228948624-228948646 GTAGCCACTTCCAAAGCCCCTGG + Intergenic
922906428 1:229176808-229176830 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
922934855 1:229414773-229414795 GCAGCCAGTTCCAGAGCCCCTGG + Intergenic
923012101 1:230096032-230096054 GCAGCCAGGCCCACAGCCCTGGG - Intronic
923146737 1:231203712-231203734 GTAGTCACTCCCAGACGCCCAGG - Intronic
923214165 1:231833532-231833554 GCAGCCACTCCCAGAGCCCCTGG - Intronic
923244788 1:232120567-232120589 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
923257241 1:232232526-232232548 GCAGCCACTCCCAGAGCCCCGGG - Intergenic
923408595 1:233686757-233686779 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
923490861 1:234482868-234482890 GAAGCCATTCCTAGTGCCCCTGG + Intergenic
923659244 1:235944277-235944299 GGATCCACTCCCAGAGGCACTGG - Intergenic
923770705 1:236935576-236935598 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
923962818 1:239103759-239103781 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
924180686 1:241436360-241436382 GCATCCACTCCCAGAGCCCCTGG + Intergenic
924896150 1:248339552-248339574 GCAGCCACTCCCAGAGGCCCTGG - Intergenic
1062930785 10:1351137-1351159 GCTGCCACTCCCAGAGCCCCTGG + Intronic
1063106378 10:2996303-2996325 GCAGCCACTCTCAGAGCCCCTGG - Intergenic
1063274596 10:4551329-4551351 TCAGCCAATCCCAGTGCCACTGG - Intergenic
1063363199 10:5473500-5473522 GCAACCACTCCCAGAGCCCCTGG + Intergenic
1063498419 10:6531128-6531150 GCAGCCCCACCCAGAGCTGCTGG + Intronic
1063509564 10:6632917-6632939 GCAGCCACTCCCAGAGGCCCTGG - Intergenic
1063527650 10:6800414-6800436 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1064327363 10:14363853-14363875 GAAGCCTCTTCCAGTGCCCCAGG + Intronic
1064886964 10:20122482-20122504 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1065093175 10:22253744-22253766 GCATCCACTCCGCGAGCCACGGG + Intergenic
1065437663 10:25718835-25718857 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1065443086 10:25772062-25772084 GCAGCCACTCCCAGAGCTCCTGG - Intergenic
1065605561 10:27414106-27414128 GCAGCCACCCCCGGGACCCCTGG - Exonic
1065610619 10:27467843-27467865 GCCGCCGCTCCTAAAGCCCCTGG + Intergenic
1065892063 10:30129920-30129942 CCATCCACACCCTGAGCCCCTGG + Intergenic
1066103364 10:32136982-32137004 ACAGCCACTCCCAGAGCCCCTGG - Intergenic
1066779449 10:38927851-38927873 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1067360438 10:45573593-45573615 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1068058317 10:52037087-52037109 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1068179627 10:53502358-53502380 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1068231005 10:54169144-54169166 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1068360805 10:55973589-55973611 GCAGCCACTACCAGAGCCCCTGG + Intergenic
1068545083 10:58335465-58335487 GGAGCCGCTCCCGGAGCCCCAGG + Intronic
1068592312 10:58864340-58864362 GCAGCCACTCCCAGAGCCCATGG - Intergenic
1069729135 10:70599862-70599884 GCAGTCACTACCCTAGCCCCTGG - Intronic
1069887095 10:71630729-71630751 GCAGCCCCTCACCGAGGCCCTGG - Intronic
1069905904 10:71731896-71731918 GCTGCCACACCCATACCCCCTGG - Intronic
1070474959 10:76820958-76820980 GCAGCCACTCCTGGAGCCCCTGG + Intergenic
1070644205 10:78190238-78190260 GCAGACACACCCAAAGGCCCGGG - Intergenic
1071187267 10:83059537-83059559 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1071532990 10:86402980-86403002 GGAGCCACACCCATATCCCCTGG - Intergenic
1071550759 10:86564560-86564582 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1071821768 10:89287084-89287106 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1071897703 10:90084363-90084385 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1071916235 10:90297394-90297416 GCAGCCACTCCCAGAGCTCCTGG + Intergenic
1071961142 10:90809814-90809836 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1072011244 10:91304810-91304832 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1072562203 10:96586801-96586823 GCCGCCACGCCAAGAGCGCCAGG + Exonic
1072580293 10:96734601-96734623 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1072884553 10:99261978-99262000 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1073014050 10:100384134-100384156 GGAGCCACTCCCAGAGCTGCTGG + Intergenic
1073071162 10:100794023-100794045 TCAGCCACTCCCAGGCTCCCAGG - Intronic
1073683553 10:105729767-105729789 GCAGCCACTCCCAGAGACCCTGG + Intergenic
1073709458 10:106020941-106020963 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1073933237 10:108600191-108600213 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1074019059 10:109564754-109564776 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1074740811 10:116483042-116483064 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1074860965 10:117510148-117510170 TCAGCCAACCCTAGAGCCCCAGG - Intergenic
1074864479 10:117536963-117536985 GCAGCCACCCGCGGAGCCCAGGG + Intergenic
1075076913 10:119357966-119357988 GCAGCCACCCCGAGAGGACCAGG - Intronic
1075092189 10:119450088-119450110 GTGGCCACTCCCAAAGCCCTTGG - Intronic
1075248730 10:120847237-120847259 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1075941545 10:126394539-126394561 ACAGCCACCAGCAGAGCCCCAGG - Intergenic
1075954329 10:126508972-126508994 GAAGCCACAGCCAGAGCCCAGGG + Intronic
1076514170 10:131033853-131033875 TCAGCCCCTCCCACAGCCTCTGG + Intergenic
1076600546 10:131654493-131654515 GCCGCTTCTCCAAGAGCCCCTGG + Intergenic
1076716886 10:132370589-132370611 GCTGCCTCTCACAGAGCGCCGGG + Intronic
1076754929 10:132564440-132564462 CCAGGGTCTCCCAGAGCCCCTGG + Intronic
1076790950 10:132776418-132776440 GCAGCCCCTCCCATGCCCCCCGG - Intronic
1077017970 11:405272-405294 GCAGCCAGTGTGAGAGCCCCTGG - Intergenic
1077204902 11:1337388-1337410 GAAGCCACCCCCAGCTCCCCCGG + Intergenic
1077258955 11:1605167-1605189 CCAGCCACACCCTGAGCCCCTGG + Intergenic
1077383194 11:2257049-2257071 CCCTCCACTCCCAGAGCCCCAGG - Intergenic
1077589850 11:3482957-3482979 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1077612218 11:3650324-3650346 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1077679037 11:4222568-4222590 GCAGCCACTTCCAGAACCCCTGG - Intergenic
1077688474 11:4319209-4319231 GCAGCCACTTCCAGAACCCCTGG - Intergenic
1077766351 11:5163607-5163629 GCAGCCACTCCTAGAGCCCCTGG - Intronic
1077850768 11:6073160-6073182 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1077883390 11:6368202-6368224 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1078093749 11:8283906-8283928 GCACCCTCCCCCACAGCCCCCGG + Intergenic
1078107749 11:8369392-8369414 TCAGCCCCTCCCACTGCCCCTGG - Intergenic
1078789021 11:14524871-14524893 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1079230543 11:18645418-18645440 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1079447492 11:20570177-20570199 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1079672539 11:23187262-23187284 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1079727042 11:23890505-23890527 GCAGCCACTTCCAGAGTCCCTGG - Intergenic
1079847656 11:25490542-25490564 GCAGCCACTCCCAGAGCCCGTGG - Intergenic
1080027883 11:27632407-27632429 GCAGCCACTCCCAGAGGCCCTGG - Intergenic
1080227392 11:29975793-29975815 GCAGCCACTCCCAGAGACCCTGG + Intergenic
1080779729 11:35419232-35419254 GAAGCCACCCTCGGAGCCCCCGG - Exonic
1080994425 11:37581943-37581965 GCAGCCACTCTGAGATGCCCTGG - Intergenic
1081356839 11:42122964-42122986 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1081616986 11:44596984-44597006 AAAGCCACACCCAGAACCCCAGG - Intronic
1081851214 11:46276521-46276543 CCAGACACTCCCAGGGCCCCGGG - Intergenic
1081995985 11:47364432-47364454 TCACCAAATCCCAGAGCCCCAGG - Intronic
1082197729 11:49324756-49324778 GCAGCTACACCCAGAGCCCCTGG - Intergenic
1083033474 11:59615465-59615487 GCCGCCACTCCCCCGGCCCCCGG + Exonic
1083448460 11:62726814-62726836 GCAGCCGCCGCCGGAGCCCCCGG - Exonic
1083534442 11:63455298-63455320 GCAGCCACTTCCAAAGCCCCTGG + Intergenic
1083630854 11:64094640-64094662 GCAGCCACACACTGAGCCTCCGG - Intronic
1083921026 11:65781375-65781397 GGGGCCACTCCGGGAGCCCCAGG - Intergenic
1084047200 11:66576007-66576029 GAAGCCAGTCCCAGAGCCCCTGG + Intergenic
1084232337 11:67762072-67762094 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1084245567 11:67854731-67854753 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1084263996 11:67995758-67995780 GCTGCCACGCCCGGTGCCCCTGG - Exonic
1084288411 11:68146523-68146545 CCAGCCGCTGTCAGAGCCCCTGG - Intergenic
1084355584 11:68636100-68636122 GCAGCCACTCCCAGAGCTCCTGG + Intergenic
1084358357 11:68653844-68653866 CCAGCCACTCCCAGCCGCCCAGG - Intergenic
1084518490 11:69648956-69648978 GCCGCTACTCCCAGTGTCCCCGG - Intronic
1084613249 11:70217630-70217652 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1084802581 11:71554861-71554883 CCAGCCACACCCTGAGTCCCTGG - Intronic
1084827121 11:71739847-71739869 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1084949525 11:72657111-72657133 GCAGCCACTTGCACAGCCCCTGG + Intronic
1085048807 11:73368839-73368861 GCAGCCTCTACCTGACCCCCTGG + Exonic
1085570226 11:77552321-77552343 GCAGCCATTCCTAGAGCCCCTGG + Intronic
1085647417 11:78235012-78235034 GCAGCCCCTCCCGGTGGCCCGGG - Intronic
1085854519 11:80161314-80161336 GCAGCAAATCCCAGGTCCCCAGG + Intergenic
1085934298 11:81124212-81124234 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1085988048 11:81808603-81808625 GCAGCCACTCCCAGAGCCCGTGG + Intergenic
1086005051 11:82027609-82027631 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1086133182 11:83421512-83421534 GCAGCCGCTCCCAGAGCCCCTGG + Intergenic
1086134801 11:83434907-83434929 GCAGCCGCTTCCAGAGCCCCTGG - Intergenic
1086136238 11:83446224-83446246 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
1086550247 11:88045580-88045602 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1086658090 11:89383371-89383393 GCAGCTACTCCCAGAGCCCCTGG + Intronic
1087099673 11:94352041-94352063 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1087127848 11:94644005-94644027 GCAGCCACTCACAGAGCCCGTGG + Intergenic
1087196948 11:95311911-95311933 GCAGCCACTCCCAGAGCCTGTGG + Intergenic
1087314708 11:96590312-96590334 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1087839509 11:102907402-102907424 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1088554992 11:111052581-111052603 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1088816108 11:113422085-113422107 GAAGCCATGCCCAGAGCCCTGGG + Intronic
1089204478 11:116748455-116748477 CCAGCCACCCCCACAGCCTCAGG + Exonic
1089349125 11:117811670-117811692 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1089397381 11:118145271-118145293 GCATCCCCTTCCAGAGCTCCAGG - Intronic
1089471022 11:118720322-118720344 GCAGCCACTCCCAGAACCCCTGG - Intergenic
1089867014 11:121641247-121641269 ACAGCCACTTCCAGGGCCCCTGG - Intergenic
1089987714 11:122829511-122829533 GCAACCACTCCCAGAGCCCCTGG + Intergenic
1090107565 11:123868921-123868943 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1090406540 11:126479148-126479170 ACTGACTCTCCCAGAGCCCCTGG - Intronic
1090659863 11:128874222-128874244 GCTACCACTCCCAGGGCTCCAGG - Intergenic
1090850564 11:130567687-130567709 GAAGCCACTCCCAGAGCCCCTGG - Intergenic
1090871926 11:130756833-130756855 GCAGCCACTCCCAGCGCCCCTGG - Intergenic
1090926906 11:131257813-131257835 GCAGCCACTCCCAGAGCTCCTGG - Intergenic
1091251816 11:134150454-134150476 ACAGCCACTGCCAGGGCCCAAGG - Exonic
1091347378 11:134864401-134864423 CCAGCCTCTCCCAGAACACCCGG - Intergenic
1091360391 11:134974739-134974761 CCAGCCACCCCCAGGGCCACCGG + Intergenic
1091823367 12:3492205-3492227 GCAGCCGCGCGGAGAGCCCCCGG + Intronic
1091886553 12:4020919-4020941 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1092416144 12:8291862-8291884 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1092474515 12:8807325-8807347 GCAGCCGCTCCCAGAGCCCCTGG + Intergenic
1092592724 12:9966391-9966413 GCAGCCACTCCCATAGCCCCTGG - Intronic
1092626718 12:10336252-10336274 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1092723689 12:11465493-11465515 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1092739292 12:11613018-11613040 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1092789739 12:12060781-12060803 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1092814470 12:12300988-12301010 GCTGCCTCTCCCAGACCACCTGG - Intergenic
1092924825 12:13263297-13263319 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1093024365 12:14232968-14232990 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1093071132 12:14708197-14708219 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1093267977 12:17025027-17025049 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1093302264 12:17471938-17471960 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1093321954 12:17723598-17723620 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1093358468 12:18197339-18197361 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1093578848 12:20765765-20765787 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1093584486 12:20820325-20820347 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1093812805 12:23509335-23509357 GCAGCCACTTTCAGAGCCCCTGG - Intergenic
1093951100 12:25165536-25165558 GCAGCCACTTTCAGAGCCCCTGG + Intronic
1094316019 12:29138325-29138347 GCAGCCATTTCCAGAGACCCTGG - Intergenic
1094400710 12:30058366-30058388 GCAGCCACTCCTAGACCCCCTGG + Intergenic
1094825784 12:34268026-34268048 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1094827893 12:34286720-34286742 GCAGCCACTGCACGAGGCCCAGG + Intergenic
1095637687 12:44452185-44452207 GCAGCCACTCCCAGAACCCCTGG + Intergenic
1095977009 12:47946769-47946791 ACAGCCAGGCCCAGAGGCCCAGG - Intergenic
1095998991 12:48113454-48113476 GCAGCCACTCCCAGATCCCCTGG - Intronic
1096101270 12:48971753-48971775 GCAGCCCCTCCCCGAGCCTGGGG + Exonic
1096111917 12:49033827-49033849 TCAGCCCTTCCCAGAGTCCCCGG - Exonic
1096907161 12:54946251-54946273 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1097186559 12:57199445-57199467 GCAGGAACTCCCAGGGACCCCGG - Intronic
1097398619 12:59104228-59104250 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1097417023 12:59326543-59326565 GCAGCCACTCCCAGATCCCCTGG - Intergenic
1097542168 12:60955306-60955328 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1097981528 12:65741683-65741705 GCAGCCACCCCCACAGCGCTAGG - Intergenic
1098173610 12:67769972-67769994 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1098402282 12:70087789-70087811 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1098629090 12:72705738-72705760 GCAGCCACTCCCAGATCCCCTGG + Intergenic
1098653797 12:73005287-73005309 GCAGCCACCCCCAGAGTCCCTGG - Intergenic
1098919938 12:76293848-76293870 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1099188748 12:79542248-79542270 GCAGCCACTCCCAAAGCCCCTGG + Intergenic
1099292069 12:80786401-80786423 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1099762617 12:86941188-86941210 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1099836069 12:87910714-87910736 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1099872816 12:88370063-88370085 GCCGCCACTCCTAAAGCCCCTGG + Intergenic
1100561391 12:95751565-95751587 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1100604473 12:96140270-96140292 GCTGCCACTCACTAAGCCCCAGG - Intergenic
1100940330 12:99717576-99717598 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1101077438 12:101145866-101145888 GCAGCCACTCCCAGAGGCCCTGG + Intergenic
1101278366 12:103226003-103226025 GCAGCCACTCCCAGATCCCCTGG - Intergenic
1101999551 12:109548416-109548438 GCTGCCTCTCCCAGAGGCCACGG + Intergenic
1102116709 12:110408589-110408611 GCAGCCACTCCCAGACCCCCTGG - Intergenic
1102197087 12:111033819-111033841 GCAGCCTCTCCGAGAGGCGCCGG - Intergenic
1102356049 12:112236907-112236929 CCAGCTTCTCCCAGAGCTCCAGG + Intronic
1102420771 12:112801111-112801133 GCAGCCTTTCCCGCAGCCCCTGG - Intronic
1102599954 12:114022151-114022173 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1103023864 12:117558024-117558046 CCAGACACTCCTAGGGCCCCAGG + Intronic
1103059083 12:117844330-117844352 CCAGCCAATCCCTGAGCCCAGGG + Intronic
1103518154 12:121520781-121520803 GGAGCCACACCCGGAGGCCCTGG - Intronic
1103705183 12:122867454-122867476 GCAGAGACTCCCACAGGCCCTGG - Exonic
1103780675 12:123396752-123396774 GCAGCCTTTCCCACAGTCCCAGG - Intronic
1104001479 12:124863430-124863452 GCAGCCCCTCCCGAAGCGCCTGG + Intronic
1104017241 12:124969277-124969299 GCAGCTCTTCCCTGAGCCCCCGG - Intronic
1104017522 12:124970905-124970927 GGAGCCCCTCTCAGAGCTCCGGG + Intronic
1104407144 12:128527235-128527257 GACCCCACTCCCAGTGCCCCAGG - Intronic
1104781003 12:131420528-131420550 TCAGCCACCCCAAGAGCACCTGG - Intergenic
1104811119 12:131621031-131621053 GCAGCCCCGCCCAGAGCCCCAGG + Intergenic
1104842441 12:131831520-131831542 GCAGCTGCTCCCAGAGCTTCAGG + Intronic
1104845917 12:131846797-131846819 GCAGCCACTCCCACAGTCACGGG + Intronic
1104908800 12:132229696-132229718 CCAGCCTCTCCCTGAGTCCCAGG + Intronic
1104913583 12:132252133-132252155 GCAGCCACCTCCACAGGCCCAGG + Intronic
1104915718 12:132263486-132263508 AGAGGCACTCCCAGAGCCCAGGG + Intronic
1106075753 13:26459518-26459540 ACAGCCACTCCCTCAGCCCAGGG - Intergenic
1106107046 13:26742147-26742169 GCAGCAACTCACAGAGCCCATGG - Intergenic
1106802720 13:33272622-33272644 GCAGCTGCACCCAGAGGCCCAGG - Intronic
1106943473 13:34801032-34801054 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1107075613 13:36318831-36318853 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1107220267 13:37972499-37972521 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1107683110 13:42870741-42870763 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1108202724 13:48058785-48058807 GGCAGCACTCCCAGAGCCCCTGG + Intronic
1108282033 13:48870446-48870468 GCAGCCACTCCCAGGGTCCCTGG - Intergenic
1108513026 13:51172256-51172278 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1108803843 13:54131014-54131036 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1108814156 13:54269245-54269267 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1108913388 13:55581568-55581590 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1108919514 13:55658297-55658319 GCAGCCACTCGCAGAGCCCCTGG - Intergenic
1108947465 13:56042700-56042722 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1108952917 13:56115741-56115763 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1109299332 13:60574756-60574778 CCAGCAACTCCCAGAGCCTAGGG + Intergenic
1109499323 13:63215512-63215534 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1109709633 13:66144660-66144682 GCAGCCACTCCCAGAAACCCTGG - Intergenic
1109716711 13:66229704-66229726 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1110324446 13:74198188-74198210 GCAGACACTGCTAGAGACCCAGG + Intergenic
1110404628 13:75136097-75136119 ACTGCCACTGCCAGAGCCCCAGG + Intergenic
1110650456 13:77936643-77936665 GCAGCCACTTCCACAGCCCCTGG - Intergenic
1110765511 13:79276524-79276546 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1110845376 13:80186061-80186083 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1110978521 13:81868563-81868585 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1111126011 13:83911604-83911626 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1111302079 13:86360795-86360817 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1111362076 13:87189750-87189772 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1111458806 13:88516148-88516170 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
1111630474 13:90841829-90841851 GCAGCCACTCCCAAAGCCCCTGG + Intergenic
1111631669 13:90851910-90851932 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1111920311 13:94403024-94403046 ACTGCCACTCCCTGAGCCACTGG - Exonic
1112236863 13:97644705-97644727 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1112590558 13:100760305-100760327 GCAGGCCCTTCCAGAGCCACTGG + Intergenic
1112776194 13:102846275-102846297 CCAGCAGCTTCCAGAGCCCCTGG - Exonic
1112889286 13:104211380-104211402 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1113324369 13:109267737-109267759 GCAGCCACTCCCAGCGCCCCTGG + Intergenic
1113513346 13:110872777-110872799 GCAGCCCCTCCCTGAGCCCTGGG + Intergenic
1113532404 13:111037803-111037825 CCCTCCAGTCCCAGAGCCCCTGG - Intergenic
1113668227 13:112155517-112155539 CCAGCCAGTCATAGAGCCCCCGG + Intergenic
1114221711 14:20702972-20702994 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1114771022 14:25429003-25429025 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1115240572 14:31248666-31248688 GCAGCCACTCCCAGAGTCCCTGG - Intergenic
1115249474 14:31330417-31330439 ACAGCCCCTCCCAGAGGCCTAGG - Intronic
1115904840 14:38193180-38193202 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1116179711 14:41518332-41518354 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1116202942 14:41822814-41822836 GCAACCAATACCAGAGCACCTGG - Intronic
1116490550 14:45498707-45498729 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1116534751 14:46015727-46015749 GCAGCCATTCCCAGAGCCCCTGG - Intergenic
1116573485 14:46546316-46546338 GCAGCCACTCCCAGAGCCCGTGG + Intergenic
1116613545 14:47106570-47106592 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1116702373 14:48258706-48258728 GCAGCCACTCCCAGAGCCCGTGG - Intergenic
1116703258 14:48265697-48265719 GCAGCCAGTCCCAGAGCCCCTGG - Intergenic
1116863499 14:50013121-50013143 GCAGCCACCACCACAACCCCGGG + Intergenic
1116952945 14:50895560-50895582 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1117801213 14:59446445-59446467 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1117957884 14:61136745-61136767 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1118385882 14:65255238-65255260 GGAGCCCTTTCCAGAGCCCCAGG - Intergenic
1119138140 14:72239444-72239466 GCAGCCAGTCCAAGGGCACCAGG - Intronic
1119317235 14:73705880-73705902 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1119560250 14:75584002-75584024 GCGGCCACTCCTAAAGCCCCTGG - Intronic
1119601303 14:75979056-75979078 CCAGCCCCACCCAGAGACCCTGG + Intronic
1119777486 14:77257978-77258000 GCTGCCACTACCAGAGACCTGGG + Exonic
1120251362 14:82064404-82064426 GCAACCACTCCCAGAGCCCCTGG - Intergenic
1120332252 14:83108482-83108504 GCAGGCACTTCCATAGCCCCAGG + Intergenic
1120438021 14:84503528-84503550 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1120539528 14:85736296-85736318 GCAGCCACTCCTGGAGCCCCTGG - Intergenic
1120618287 14:86733738-86733760 GCAGCCACTCCCAGATCCCCTGG + Intergenic
1121004899 14:90483868-90483890 GCTGCCTCTCCCAGAGCCCAAGG - Intergenic
1121429758 14:93878590-93878612 GCAGCAACTCCTGGACCCCCAGG - Intergenic
1121566556 14:94914466-94914488 GCTGCCACTTCCAGAGGGCCTGG + Intergenic
1121703683 14:95975337-95975359 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1121980552 14:98450447-98450469 GTAGCCACTTCTAGAGCCCCTGG - Intergenic
1122041028 14:98987588-98987610 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1122209696 14:100166298-100166320 GCAGGCTCCCCCACAGCCCCGGG - Intergenic
1122209706 14:100166320-100166342 GCAGGCTCCCCCACAGCCCCGGG - Intergenic
1122209728 14:100166365-100166387 GCAGCCTCCCCCACAGCCCCGGG - Intergenic
1122316609 14:100829078-100829100 GCAGCCACTCACTGACCCCCAGG + Intergenic
1122318428 14:100839262-100839284 GAAGCCACTCCCAGCGACCCAGG - Intergenic
1122507667 14:102242017-102242039 GCAGCCACTCCCAGAGTCCCTGG + Intronic
1122624068 14:103075351-103075373 GCACCCCCTCCCAGACCGCCTGG + Intergenic
1122627433 14:103091586-103091608 CCAGCCACGCCCAGAGCCCGCGG + Intergenic
1122786342 14:104165984-104166006 GCAGAGTCTCCCAAAGCCCCCGG - Intronic
1123002213 14:105301489-105301511 CCCACCACTCCCAGAGCCCGGGG - Exonic
1123006123 14:105324741-105324763 GCAGGCTCTCCAGGAGCCCCAGG + Intronic
1202937812 14_KI270725v1_random:108402-108424 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1123395398 15:19929485-19929507 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1123882463 15:24688902-24688924 GCAGCCACTCCCAGAGTCCCTGG - Intergenic
1124005608 15:25793322-25793344 GCAGCATCTCCCAGGGCCCTGGG - Intronic
1125045808 15:35241159-35241181 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1125131485 15:36288964-36288986 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1125213185 15:37239518-37239540 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1126530121 15:49702459-49702481 GCAGCCACTCTCAGAGCCCCTGG - Intergenic
1126843779 15:52740976-52740998 GTGGCCACTCCCAGAGCCCCTGG + Intergenic
1126849512 15:52788822-52788844 GCAGCCACTTCCACATCCTCCGG + Exonic
1126912375 15:53430155-53430177 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1128556923 15:68638112-68638134 GCAGCCTCTCCCTGGGCCCAGGG - Intronic
1129205167 15:74033193-74033215 GCAGCCAGACCCAGTGCCCCAGG + Exonic
1129235541 15:74221792-74221814 GCAGCCCTTCCCAGAGGCTCAGG + Intergenic
1129237982 15:74235141-74235163 GCCCCCAGCCCCAGAGCCCCAGG + Intergenic
1129259467 15:74356318-74356340 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1129541074 15:76347235-76347257 TCAGCAACTCCCGGAGCCGCAGG - Intergenic
1130017916 15:80201723-80201745 ACAGCCACCCACAGAGCGCCAGG + Intergenic
1130304582 15:82704641-82704663 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1130781098 15:87042040-87042062 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1130855142 15:87833656-87833678 GCAGCCACTCCCAGAGCCCTTGG + Intergenic
1130908112 15:88254057-88254079 TCACCCATTCCCAGAGACCCAGG + Intronic
1130945914 15:88550824-88550846 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1130960089 15:88653393-88653415 CCAGCCCCTCCCCGAGCCTCAGG - Intronic
1131447781 15:92513900-92513922 GCAACCACTCCCAGAGCCCCTGG + Intergenic
1131684212 15:94753163-94753185 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1131684737 15:94756861-94756883 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1131882484 15:96875147-96875169 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1132142946 15:99409813-99409835 GCAGCCTCTCACACAGCACCAGG - Intergenic
1132223608 15:100123829-100123851 GCAGCCCCTCCCAGAGGCAGAGG - Intronic
1132263043 15:100442676-100442698 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1132340446 15:101074926-101074948 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1132373695 15:101314603-101314625 GAAGCCAGCCCCAGAGCCCAGGG - Intronic
1132400029 15:101499411-101499433 GCAGCCTCTCCCAGAGCCTTGGG + Intronic
1132553186 16:561513-561535 GCAGCCCCTCGGGGAGCCCCAGG + Intronic
1132556643 16:575529-575551 GCAGCAACTCCCACGGGCCCAGG - Intronic
1132606619 16:796327-796349 GCAGTCACTCTCGGGGCCCCCGG - Intronic
1132701461 16:1223918-1223940 GCAGCCACCCCCAGCACCCCGGG - Intronic
1132720831 16:1314829-1314851 GCCGCCAGTCCCTGTGCCCCAGG - Intronic
1132728437 16:1348829-1348851 ACAGCCACTCACTGAGTCCCTGG - Exonic
1132733760 16:1375673-1375695 GCAGCCAGGCCAAGACCCCCTGG + Intronic
1132744241 16:1430139-1430161 GGAGCCACTCCTGGAGGCCCTGG + Intergenic
1132763575 16:1523432-1523454 GCAGCCATTCCCACAGCCTCTGG + Intronic
1132993583 16:2810953-2810975 GCAGCCATACCCTGATCCCCAGG - Intergenic
1133146541 16:3791267-3791289 GCAGGGAGCCCCAGAGCCCCAGG + Intronic
1133651425 16:7817098-7817120 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1133869512 16:9674436-9674458 GCAGCCACTGCCAGAGTCGCTGG - Intronic
1133938206 16:10285544-10285566 GCAGCCACTTCCAGAGTCCCTGG + Intergenic
1134063715 16:11213569-11213591 GCACCCTCTCCCAGGGCCCCGGG - Intergenic
1134342147 16:13355891-13355913 GCAGCCACTCCCGGAGCCCCTGG - Intergenic
1134531689 16:14989009-14989031 TCAGCCCCTCCCTGAGCCACAGG - Intronic
1135025379 16:18995452-18995474 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1136022111 16:27446873-27446895 GCAGCCACTCCCACTGCTGCAGG - Intronic
1136069880 16:27781326-27781348 CCAGCCCCTGCCAGAGCCCTGGG + Intergenic
1136070289 16:27783269-27783291 GGAGGCACCCCCAGAGCACCTGG - Intergenic
1136567465 16:31078915-31078937 GCAGCCACTTCCAGAACCATAGG + Exonic
1136697719 16:32100393-32100415 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1136701492 16:32147921-32147943 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1136769860 16:32827223-32827245 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1136798216 16:33043675-33043697 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1136940015 16:34514977-34514999 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1136948593 16:34687395-34687417 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1136959804 16:34833589-34833611 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1137092990 16:36217914-36217936 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1137363462 16:47840914-47840936 GCAGCCACTCCTAGAGCCCTTGG + Intergenic
1138489284 16:57366817-57366839 GCCGCCACCTCCAGGGCCCCTGG - Intergenic
1138759067 16:59520951-59520973 GCAGCCACTCCCAGAGTCCCTGG - Intergenic
1138804980 16:60081222-60081244 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1139039205 16:62982466-62982488 GTAGCCACTTCCAGAGCCCCTGG - Intergenic
1139225883 16:65233155-65233177 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1139230567 16:65278572-65278594 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1139576636 16:67846537-67846559 GCTGCCCCTCCCTGGGCCCCTGG - Intronic
1139649408 16:68354925-68354947 CCAGCCAGGCCCAGGGCCCCGGG + Intronic
1139910697 16:70395614-70395636 CCAGCCACTCCCTGAGCCCCAGG + Intronic
1139943019 16:70619787-70619809 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1139943687 16:70624104-70624126 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1139997641 16:70995929-70995951 ACAGCCACACCCACAGCACCTGG - Intronic
1140917246 16:79505561-79505583 ACAGCCACTCCCAGGGCGCAGGG + Intergenic
1141446368 16:84061319-84061341 GGCTCCACTCCCAGTGCCCCAGG + Intronic
1141639063 16:85330558-85330580 GCAGCCCCTCACAGTGCCCCAGG - Intergenic
1141665417 16:85463033-85463055 GCAGCCCCTCCTAGAGGCCCCGG + Intergenic
1141865173 16:86745344-86745366 GCAGCCACTCGCAGAGCCCCTGG - Intergenic
1141924712 16:87160533-87160555 GCAGCTCCGCCCAGTGCCCCTGG - Intronic
1142277883 16:89132527-89132549 GCAGGCACTGCCATGGCCCCAGG - Intronic
1142279827 16:89142041-89142063 GGTGCCATTCCCAGGGCCCCAGG - Intronic
1203068559 16_KI270728v1_random:1041789-1041811 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1203072281 16_KI270728v1_random:1089327-1089349 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1142808634 17:2385036-2385058 GCTGGCTCTCCCAGAGCCACGGG + Exonic
1144104704 17:11974285-11974307 GCAGACACTCCCAGAGCCCCTGG + Intergenic
1144490443 17:15704326-15704348 TCAGCCCCTCCCAGGCCCCCTGG + Intronic
1144712988 17:17414574-17414596 GCTGCCAACCCCACAGCCCCAGG - Intergenic
1145080631 17:19891782-19891804 GCAGCCACTCCCAGCGCACCTGG - Intergenic
1145692021 17:26751907-26751929 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1145708755 17:26948520-26948542 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1145747857 17:27333212-27333234 CCAGCCCCTCCCAGACGCCCCGG + Intergenic
1145972911 17:28967519-28967541 GCAGCCACTCACAGTGACCTGGG + Intronic
1146167533 17:30601215-30601237 GCTGCTGCTCCCCGAGCCCCGGG - Intergenic
1146196976 17:30821760-30821782 GCTGTCACTCCCATACCCCCTGG - Intronic
1146597929 17:34185664-34185686 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1146629794 17:34461718-34461740 GCAGACATTCCAAGAGCCCCAGG + Intergenic
1147448608 17:40490103-40490125 GCAGGCACTCCCTGAGCACAGGG + Intronic
1147673471 17:42190050-42190072 CCCTCCCCTCCCAGAGCCCCAGG + Intronic
1147725070 17:42561998-42562020 TCACCCACTCCCAGAGCCTTCGG + Intronic
1147935373 17:44007693-44007715 GCAGGCACTCCCACAGCATCTGG - Exonic
1148148249 17:45379545-45379567 GCAGGCACTTACACAGCCCCTGG - Intergenic
1148462543 17:47846909-47846931 ACAGCCACCACCAGCGCCCCGGG + Exonic
1148465281 17:47861233-47861255 TCTGCCACCCCCAGAGCTCCAGG - Intergenic
1148773740 17:50081578-50081600 GAATCCACTCCCAGGGACCCGGG - Intronic
1149319600 17:55470189-55470211 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1149608706 17:57943190-57943212 GGAGCCCTTCCCAAAGCCCCTGG + Intronic
1149929195 17:60733368-60733390 GCAGCCAATACCTGAGACCCCGG - Intronic
1150127710 17:62649072-62649094 GCAGCCAATCCCAGGGCCCAAGG + Intronic
1150525377 17:65917049-65917071 GCTGCCAGACTCAGAGCCCCAGG - Intronic
1150921883 17:69492579-69492601 GGATCCTCTCCCAGAGCCTCTGG - Intronic
1151268975 17:72978528-72978550 GCAGCCACGCACAGAGCTTCGGG + Intronic
1151404493 17:73877833-73877855 CAAGCCACTCCCAGGGCTCCAGG + Intergenic
1151622519 17:75254963-75254985 ACAGCCACTCCCAGAGCCCCTGG + Intronic
1151829109 17:76539107-76539129 CCAGCCCCTCCAAGACCCCCAGG - Intronic
1151839722 17:76609274-76609296 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1151883069 17:76906260-76906282 GCAGGTGCTCCCACAGCCCCTGG - Intronic
1151939873 17:77285872-77285894 GCACCCTCACCCAGCGCCCCGGG + Intronic
1152063282 17:78095205-78095227 GAGGCCACTCCCAGTGGCCCTGG - Intronic
1152070588 17:78131993-78132015 GCGCCCCCTCCCAGAGCCCAAGG - Exonic
1152277222 17:79364900-79364922 CCAGCCACTCCCTGGGCACCAGG - Intronic
1152286789 17:79417251-79417273 TCAGCCTCTCCCAAAACCCCTGG + Intronic
1152449110 17:80365211-80365233 GCTGCCTCTTCCAGACCCCCTGG - Intronic
1152586842 17:81193052-81193074 GCAGCAATTCCCTGAGCTCCAGG + Intronic
1152628751 17:81400129-81400151 GCTGCCCCTCCGAGACCCCCGGG - Intronic
1152923370 17:83076917-83076939 GCAGACCCTCCCAGAGGACCAGG + Intergenic
1203183543 17_KI270729v1_random:89445-89467 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1153854840 18:9136192-9136214 GCACCTACGCCCAGAGCCCGCGG - Intergenic
1154219522 18:12440136-12440158 CCAGTCACACCCAGAGCCCCTGG + Intergenic
1154948243 18:21183441-21183463 GCAGCCACTCCAAAAACACCAGG + Intergenic
1155173852 18:23286441-23286463 GCAGCCACTCCCAGAGTCCCTGG + Intronic
1155696985 18:28696420-28696442 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1155892666 18:31287555-31287577 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1155962029 18:32002997-32003019 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1156237390 18:35218159-35218181 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1156251900 18:35359629-35359651 GCTGCCACTTCCAGAGCCCCTGG - Intergenic
1156466172 18:37348942-37348964 GCAGCCTCTCCCAAACCCCCTGG - Intronic
1156924023 18:42555810-42555832 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1156938566 18:42739042-42739064 GCAGCCACTCCCAGAGCCCGTGG + Intergenic
1156958210 18:42993264-42993286 GTAGCCACTCCCAGAGTCCCTGG + Intronic
1157555124 18:48608508-48608530 GCAGCCACTCACTGGGCCCTTGG - Intronic
1157906360 18:51573358-51573380 GCAGCCGCTCCCAGAGCCCCTGG - Intergenic
1158336408 18:56417981-56418003 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1158394613 18:57069946-57069968 ACAGCCACTCCCACAGCCGCTGG - Intergenic
1158576664 18:58644301-58644323 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1159164497 18:64684031-64684053 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1159646147 18:70920957-70920979 GCAGCCATTGCCATAGCTCCAGG + Intergenic
1159835084 18:73327027-73327049 GCAGCCACTGCCAGAGCCCCTGG + Intergenic
1159929246 18:74294822-74294844 GCAGCCATTCCTAGAGTTCCTGG + Intergenic
1160144289 18:76350811-76350833 TCAGCACCTCCCAGAGCACCGGG + Intergenic
1161050695 19:2162745-2162767 GCAGTCACTGCCACAGCCCCTGG - Intronic
1161109699 19:2462347-2462369 GCAGCTGCGCCCAGAGCCCGAGG + Intergenic
1161615016 19:5265258-5265280 CCAGGCAGTCCCTGAGCCCCAGG - Intronic
1161661752 19:5550861-5550883 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1161692680 19:5746070-5746092 GCAGCCCCACCCTGGGCCCCTGG - Intronic
1161712073 19:5854500-5854522 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1161919210 19:7253626-7253648 GCAGCCACTCCTCGGGCCCCAGG + Intronic
1162033293 19:7926326-7926348 GCTGCCACTCCCACCTCCCCTGG + Intergenic
1162262242 19:9542624-9542646 GCAGCCACTACCAGAGCCACTGG + Intergenic
1163392198 19:17037485-17037507 TCAGACACTCCCAGGGCCCGGGG + Intergenic
1163436969 19:17301685-17301707 GCAGGCACTCCCTGAGCCTTGGG + Intronic
1163487321 19:17595819-17595841 GCAGTCACTCCCAGAGCCCCTGG + Intergenic
1163546986 19:17946567-17946589 GCAGCCCCTCACTGAGCCCTGGG + Intergenic
1163602521 19:18257570-18257592 TCTGCCACTCCCTGAGCTCCAGG - Exonic
1163712350 19:18854251-18854273 GCAGCCACATCCTGGGCCCCAGG - Intronic
1163907214 19:20157923-20157945 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1163944420 19:20522400-20522422 GCAGCCACTCCTAGAGCCCCTGG - Intergenic
1163958449 19:20665201-20665223 GCAGCCATTTCTAGAGCTCCTGG - Intronic
1164004059 19:21133095-21133117 GCAGCCACTTCTAAGGCCCCTGG - Intergenic
1164080836 19:21860192-21860214 GCAGCCACTCCCAGAGCCTCTGG + Intergenic
1164153003 19:22570631-22570653 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1164459194 19:28433182-28433204 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1164869991 19:31635022-31635044 GGGGCCACTCCTAGAGACCCAGG - Intergenic
1164930515 19:32172213-32172235 GCAGCCACTGTCAGATCCCTGGG - Intergenic
1165075297 19:33276925-33276947 TGACCCACTTCCAGAGCCCCAGG - Intergenic
1165249270 19:34516380-34516402 GCAGCCACTCTCAGAGCCCCTGG + Intergenic
1165382435 19:35490569-35490591 CCTCCCCCTCCCAGAGCCCCGGG - Intronic
1165496976 19:36158737-36158759 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1165501737 19:36194846-36194868 GTAGCTACTTCCAGAGCTCCTGG - Intronic
1165510290 19:36262803-36262825 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1165835391 19:38752001-38752023 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1166073087 19:40397906-40397928 GCGGGGACCCCCAGAGCCCCAGG + Exonic
1166226336 19:41397909-41397931 CTAGCCAGTCCCCGAGCCCCAGG - Exonic
1166498908 19:43326822-43326844 GCAGCCACTCCCAGAGCCCAAGG - Intergenic
1166523350 19:43495712-43495734 CCAGCCACTCCCAGAGACCATGG + Intronic
1166538808 19:43592559-43592581 GCAGCCATTCGCATAGCCCTGGG + Exonic
1166876652 19:45901876-45901898 GCCGCCTCTCCCAGACCGCCGGG + Intronic
1166905763 19:46107370-46107392 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1166994873 19:46715606-46715628 GCAGGCACTCCTACAGACCCTGG - Intronic
1167046570 19:47053066-47053088 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1167115918 19:47489038-47489060 GCATCCCCTCCCTGAGCTCCTGG + Intronic
1167158754 19:47754720-47754742 GCAGCCCCTCGCACAGCTCCTGG - Exonic
1167158980 19:47755536-47755558 CCAGCCTCTCCCAGAACCCCCGG - Intronic
1167269215 19:48498524-48498546 GCTCCCACTCCCGGGGCCCCGGG - Exonic
1167471489 19:49678321-49678343 GCACCCACTCTCAGGACCCCAGG - Intronic
1167590455 19:50401940-50401962 CCAGCCCCTCCCTGAGCCACTGG + Intronic
1167796621 19:51713627-51713649 GCAGCAGCGCCCAGAGCGCCAGG + Exonic
1167902181 19:52630162-52630184 GCAACCACTCCCAGAGCCCCTGG + Intronic
1168051673 19:53834000-53834022 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1168227955 19:55010103-55010125 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1168248172 19:55124931-55124953 GCAGCCACTCCCAAAGCCCCTGG + Intergenic
1168316207 19:55485797-55485819 GCAGCCACTCCCAGGCCCCCTGG - Intronic
1202671662 1_KI270709v1_random:59990-60012 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1202682008 1_KI270712v1_random:14762-14784 AGAGCCACTCTCAGAGACCCTGG - Intergenic
925075082 2:1009581-1009603 GCAGCCACACCCATGTCCCCAGG + Intronic
925433824 2:3819223-3819245 GCAGCCACTCCCAGAACCCCTGG - Intronic
925544582 2:5003368-5003390 GCAGCCACTCCCAGCGCCCCTGG + Intergenic
925828788 2:7875981-7876003 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
926152791 2:10434265-10434287 GCAGCCCCTCCCTCTGCCCCTGG - Intergenic
926407798 2:12572147-12572169 GAAGCCACTCCCAGAGCCCCTGG + Intergenic
926413620 2:12628892-12628914 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
926464062 2:13167310-13167332 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
926761153 2:16280213-16280235 GCAGCCACTCCATGGCCCCCTGG - Intergenic
926815516 2:16795261-16795283 GCAGCCACTCCCAGATCCCCTGG - Intergenic
927134189 2:20084706-20084728 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
927368791 2:22330562-22330584 GCAGCCCCTCTCACAGCACCAGG - Intergenic
927698337 2:25252247-25252269 GCAGCTACTTCCAGAGCTTCAGG - Intronic
927810188 2:26176150-26176172 ACAGCCAGCCCCACAGCCCCAGG + Intronic
927909098 2:26884015-26884037 GCAGCCACTCCAGGAGCTGCTGG + Intronic
928088759 2:28361396-28361418 AGAGACACTCCCAGGGCCCCAGG - Intergenic
928158035 2:28894581-28894603 AGATCCACTCCCTGAGCCCCCGG + Intergenic
928278281 2:29921555-29921577 GCTGCCGCCCCCAGAGCCGCTGG + Exonic
928770210 2:34696243-34696265 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
928770790 2:34700416-34700438 GCAGCCACTGACAGAGCCCCTGG - Intergenic
928778334 2:34792098-34792120 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
928779673 2:34804286-34804308 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
928827627 2:35440417-35440439 GCAGCCACTCCCAGAGCCGCTGG - Intergenic
928857203 2:35815471-35815493 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
928928595 2:36601427-36601449 GTAGCCACTTCCAGAGCCCCTGG + Intronic
929004809 2:37384297-37384319 GCAGCCACTCCCAGAGGCCCTGG - Intergenic
929076643 2:38084085-38084107 GCAGCCACTCCCAGAGCCCCTGG - Intronic
929567690 2:43000002-43000024 GCAGCCACACCCAAAACCCCAGG + Intergenic
929684494 2:44022363-44022385 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
929793034 2:45037755-45037777 GTAGCCACTTCCAGAGCCCCTGG - Intergenic
930487331 2:52025433-52025455 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
930955129 2:57195357-57195379 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
930958417 2:57231286-57231308 GCAGCCACTCCCAGCACCCCTGG + Intergenic
931026360 2:58116735-58116757 GCAGCCACTCCCAGAGCCCCTGG - Intronic
931042646 2:58316087-58316109 GCAGCCACTCCCAAAGCCCCTGG + Intergenic
931236969 2:60420002-60420024 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
931608896 2:64078490-64078512 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
931625810 2:64254919-64254941 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
931721809 2:65072288-65072310 GCATCTACCCCCAGAGCCCCAGG + Exonic
931850453 2:66246322-66246344 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
931948288 2:67333988-67334010 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
932159429 2:69446971-69446993 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
932292407 2:70593744-70593766 GCTGCCAGTCCCACAGCCCCAGG + Intergenic
932295884 2:70623018-70623040 GCAGCCACTTCCAGAGCCCCTGG + Intronic
932358787 2:71088363-71088385 GCAGCCACTCCCAGAGTCCCTGG - Intergenic
932367616 2:71163003-71163025 GCAGCCACTCCCACAGCCCCTGG - Intergenic
932854179 2:75217112-75217134 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
932973926 2:76577173-76577195 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
933013119 2:77090767-77090789 GCAGCCACTCCCAGAGCCCCTGG + Intronic
933079300 2:77967500-77967522 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
933137967 2:78760288-78760310 ACAGCCACTCCCAGAGCCCCTGG + Intergenic
933163759 2:79053775-79053797 GCAGCCACTCCAAGAGCCCCTGG + Intergenic
933179740 2:79215138-79215160 GCAGCCACTCCCAGAGCCCCTGG - Intronic
933329491 2:80877786-80877808 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
933552361 2:83792230-83792252 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
934141294 2:89050310-89050332 GCAGCCACTCCCAGAGCCACTGG + Intergenic
934227946 2:90150234-90150256 GCAGCGACTCCCAGAGCCACTGG - Intergenic
934249765 2:90340331-90340353 AGAGCCACTCTCAGAGACCCTGG + Intergenic
934259808 2:91463115-91463137 AGAGCCACTCTCAGAGACCCTGG - Intergenic
934303113 2:91795044-91795066 AGAGCCACTCTCAGAGACCCTGG - Intergenic
934330146 2:92057712-92057734 AGAGCCACTCTCAGAGACCCTGG + Intergenic
934468369 2:94287621-94287643 AGAGCCACTCTCAGAGACCCTGG + Intergenic
934604482 2:95683402-95683424 TCAGCCACACCCTGATCCCCTGG + Intergenic
934863042 2:97780350-97780372 ACTGCCACTCCCTGAGCCCAGGG + Intronic
935116030 2:100137263-100137285 ACAGTCATTCCCAGAGCACCTGG - Intronic
936007948 2:108906843-108906865 GCTGCCACTTGCAGAGACCCTGG - Intronic
936479449 2:112871497-112871519 GCAGCCACTCCAGTAGCCCCTGG - Intergenic
936537884 2:113325633-113325655 TCAGCCACACCCTGATCCCCTGG + Intergenic
936623473 2:114123919-114123941 GCAGCTGCTCCCAAAGCCTCTGG - Intergenic
936794258 2:116187588-116187610 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
936883366 2:117281132-117281154 GCAGCCACTCCCAGAGCCCTTGG + Intergenic
937315638 2:120930579-120930601 CCAGTCGCTCCCAGAACCCCTGG + Intronic
937859400 2:126696328-126696350 GAGGCCACTCCCAGGGACCCAGG + Exonic
937877400 2:126835991-126836013 TCAGGCATTCCCAAAGCCCCCGG - Intergenic
938144217 2:128820642-128820664 GGAGCCTCTGCCAGAGCACCTGG + Intergenic
938519489 2:132052814-132052836 AGAGCCACTCTCAGAGACCCTGG + Intergenic
939083109 2:137686263-137686285 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
939307446 2:140428530-140428552 GCAGCCACTCCCAGAGGCCCTGG + Intronic
939414817 2:141882201-141882223 TCAGCCACCCCCAAAGCCCACGG + Intronic
939460706 2:142493162-142493184 GCAGCCACTCCCAGAACCCCTGG - Intergenic
940107378 2:150115001-150115023 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
940446526 2:153784596-153784618 TCAGGCACTCCCAGAGCCCCAGG + Intergenic
940508758 2:154586557-154586579 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
940530219 2:154869712-154869734 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
940675771 2:156723388-156723410 GCAGCCACTCCCAGAGCCTCTGG - Intergenic
940726408 2:157341434-157341456 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
941340431 2:164298246-164298268 GCAGCCACTCGCAGAGCCCCTGG + Intergenic
941353416 2:164461501-164461523 GCAGCCACTCCCAGAGGCCCTGG + Intergenic
941456160 2:165713815-165713837 GCAGCCACTCCCAGAGCTCCTGG - Intergenic
941935862 2:170980958-170980980 GCAGCCACTCTCAGAGCCCCTGG - Intergenic
942097113 2:172544129-172544151 GCAGCCACTCGCAGAGCCCCTGG + Intergenic
942730260 2:179055075-179055097 GCAGTCACTCCCAGAGCCCCTGG - Intergenic
942997016 2:182275172-182275194 GCAGGAACTCCCAAAGCCACTGG - Intronic
943061600 2:183046277-183046299 GCAGCCACTCCCAGACCCCCTGG + Intergenic
943412900 2:187563798-187563820 GCAGCCACTCCCAGAGCCCCTGG - Intronic
943421555 2:187673797-187673819 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
943450155 2:188035599-188035621 GCAGCCGCTTCCAGATCCCCTGG + Intergenic
943461165 2:188172524-188172546 GCAGTCATTCCCAGAGCCTCTGG - Intergenic
943806677 2:192132813-192132835 GCAGCCACTCCCAGAGCCCCTGG + Intronic
943835431 2:192509871-192509893 TCAGCCACTTCCAGAGTCCCTGG + Intergenic
943865370 2:192920450-192920472 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
943951259 2:194134198-194134220 GCAACCACTCCCAGAGCCCCTGG - Intergenic
944251066 2:197580504-197580526 GCAGCCACTCCCAGAGCCCCTGG + Intronic
944387479 2:199181756-199181778 GCAGCCACTCCCAGAGTCCCTGG + Intergenic
944394171 2:199249316-199249338 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
944876098 2:203965235-203965257 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
945103740 2:206288817-206288839 GCAGCCACACCCTGCTCCCCAGG - Intronic
945153071 2:206810177-206810199 GCAGCCACTCCCAGAGTCCCTGG - Intergenic
945173491 2:207019638-207019660 GCAGCCACTCCCAGAGTCCCTGG + Intergenic
945361678 2:208901631-208901653 GCAGCCACTCCCAGAGTCCCTGG + Intergenic
945376133 2:209080462-209080484 GCAGGCACTCCCAGAGCCCCAGG + Intergenic
945394334 2:209301614-209301636 GCAGCCACTCCCAGAGCTGCTGG + Intergenic
945554720 2:211263859-211263881 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
945771202 2:214045080-214045102 GCAGCCCCTCCCCCAGCCCCAGG + Intronic
945858151 2:215091979-215092001 GCAGCCACTCCCAGAGCCCCTGG + Intronic
945938351 2:215924762-215924784 GCAGCCACTCCCAGAGCCTCTGG + Intergenic
946176038 2:217922490-217922512 CCTGCCACTGCCAGGGCCCCAGG + Intronic
946215004 2:218177351-218177373 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
946282007 2:218672401-218672423 GCACCCGCTCTCAGACCCCCTGG - Exonic
946555682 2:220854220-220854242 GCATCCACTCCCAGAACATCTGG - Intergenic
946781013 2:223193160-223193182 GCAGCCACTCCCAGAGCCCCTGG - Intronic
946871726 2:224091170-224091192 GCAGCCACTTCCAGAGTCCCTGG - Intergenic
946886529 2:224227681-224227703 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
946893305 2:224299066-224299088 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
947758565 2:232587152-232587174 TTGGCCATTCCCAGAGCCCCAGG - Intergenic
948390717 2:237609346-237609368 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
948463683 2:238142283-238142305 CCAGCCAGTCACAGAGCGCCCGG + Intronic
948901266 2:240957923-240957945 GCATCAGCTCCCAGGGCCCCAGG - Intronic
1168800853 20:642482-642504 GCGGCCCCTTCCAGAGCCCGAGG - Intergenic
1168839297 20:898934-898956 CCAACCACACCCAGAGCCCCTGG + Intronic
1168943250 20:1731062-1731084 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1169200491 20:3706846-3706868 GCAGCCCTTCTCAGTGCCCCAGG + Intronic
1169254522 20:4086690-4086712 GCAGCCCCTCCCTGATTCCCAGG + Intergenic
1169500701 20:6157933-6157955 GCAGCCAATGCCAGACCCCAAGG - Intergenic
1170068837 20:12343595-12343617 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1170106263 20:12756263-12756285 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1170165772 20:13359352-13359374 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1170612887 20:17928878-17928900 GCAGCCTCGCCAAGGGCCCCTGG - Intergenic
1170680405 20:18520917-18520939 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1170792972 20:19522754-19522776 GCAGCCTCTCCTGGAGCCCTGGG - Intronic
1170820672 20:19754465-19754487 GCAGCCACTCCCCGAGCCCCTGG - Intergenic
1171317685 20:24209797-24209819 GCAGCCACTCCCATAGCTAGTGG - Intergenic
1172045148 20:32074829-32074851 CCAGCCAAGCCCAGAGCCCTGGG - Intronic
1172445368 20:34990519-34990541 CCCGTCCCTCCCAGAGCCCCAGG - Intronic
1173101945 20:40095739-40095761 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1173118901 20:40271449-40271471 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1173190074 20:40869516-40869538 GCAGCCATTCCCCAAGCCTCTGG + Intergenic
1173458524 20:43223217-43223239 GCAGCGAGGTCCAGAGCCCCTGG + Intergenic
1173652064 20:44672747-44672769 ACTGCCACTCCTAAAGCCCCTGG + Intergenic
1173763747 20:45587517-45587539 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1174057846 20:47810716-47810738 GGAGCCACTTCCAGGACCCCTGG - Intergenic
1174457822 20:50662119-50662141 CCAGCCACTTCCAGACCCACGGG + Intronic
1175257419 20:57655697-57655719 CCAACCACTCCCAGACTCCCAGG + Intronic
1175795040 20:61765970-61765992 GGAGCCAATCCCAGAGGCGCGGG - Intronic
1175888506 20:62305617-62305639 GCAGGGACTCCCAGTGTCCCTGG + Intronic
1175944899 20:62554110-62554132 CCAGCCACCCCCAGGGGCCCAGG - Intronic
1176093605 20:63329640-63329662 CCTGTCACTCCCAGAGGCCCTGG - Exonic
1176121903 20:63457810-63457832 GCTGCAGCTCCCAGAGCCCCTGG - Intronic
1176139527 20:63538892-63538914 CCAGCCCCTCCCAGATACCCAGG + Intergenic
1176291891 21:5050143-5050165 GCAGCCCTGCCCAGGGCCCCAGG + Intergenic
1176546824 21:8205829-8205851 GCAGCCACACACGGAGCGCCCGG - Intergenic
1176554729 21:8250038-8250060 GCAGCCACACACGGAGCGCCCGG - Intergenic
1176565775 21:8388876-8388898 GCAGCCACACACGGAGCGCCCGG - Intergenic
1176573650 21:8433063-8433085 GCAGCCACACACGGAGCGCCCGG - Intergenic
1176585517 21:8580730-8580752 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1177031143 21:15983111-15983133 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1177062982 21:16396654-16396676 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1177100656 21:16894567-16894589 GTAGCCACTCCCAGGGCCCCTGG + Intergenic
1177102708 21:16916379-16916401 GTAGCCACTCCCAGGGCCCCTGG + Intergenic
1177119597 21:17123884-17123906 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1177840716 21:26231359-26231381 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1178001229 21:28163605-28163627 GCAGCCACTTCCACAGCCCCTGG + Intergenic
1178218386 21:30626556-30626578 GCAGCCACAGCCATAGCCCAGGG - Intergenic
1178378901 21:32092152-32092174 GCAGCCAATTCCAGAGTCCTTGG - Intergenic
1178829512 21:36044155-36044177 GTGGCCACCCCCAGAGCCCTAGG - Intronic
1179015252 21:37590330-37590352 ACAGCCACTCCCAGAGCCCCTGG - Intergenic
1179248234 21:39651384-39651406 CCAGCCACTCCCAGAGCCTGCGG - Intronic
1179271333 21:39853348-39853370 GCAGCCAGTACCAGTGCCCGTGG + Intergenic
1179387587 21:40957341-40957363 ACAGCCACTCCCAGAACCCCTGG + Intergenic
1179597223 21:42451036-42451058 GCAGCCACTCCCAGGCTCCTGGG - Intergenic
1179650334 21:42804346-42804368 GCAGCCACTTCCAGAGTGCCTGG - Intergenic
1179894003 21:44351291-44351313 GCAGCCCCTCCCTCAGCCCCGGG - Intronic
1180057049 21:45364526-45364548 GCAGTCCCTCCCAGGGCCGCTGG + Intergenic
1180067816 21:45421331-45421353 GCAGAGACTCCCAGAACCACAGG + Intronic
1180091033 21:45533933-45533955 GCAGCCTTCCCCTGAGCCCCTGG - Intronic
1180268325 22:10557629-10557651 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1180918983 22:19508770-19508792 ACAGTCACTCCCACAGCCCTGGG - Intronic
1180921666 22:19524517-19524539 GCAGCCAATCACAGAGCCTCTGG + Exonic
1181132629 22:20742257-20742279 GCAGCCACTCCCAGCAGGCCAGG + Exonic
1181148566 22:20866281-20866303 GCTGCCACAGTCAGAGCCCCGGG + Intronic
1181339194 22:22165022-22165044 GCTGTCCCTCCCAGAGCCTCTGG + Intergenic
1181348916 22:22241550-22241572 GCAGCCTCCCCGACAGCCCCAGG - Intergenic
1181518724 22:23433313-23433335 GACGCCACTCCGAGAACCCCGGG - Intergenic
1182113981 22:27744374-27744396 GCAGCCACTCCCAGAGGCCCTGG + Intergenic
1182678062 22:32055639-32055661 ACAGCCTCTCCCTGTGCCCCTGG + Intronic
1182732308 22:32505168-32505190 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1182998634 22:34836704-34836726 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1183025273 22:35060862-35060884 CCAGCCACACCCCCAGCCCCTGG - Intergenic
1183329197 22:37210404-37210426 GTCGCCCCTCCCAGAACCCCTGG + Intronic
1183649173 22:39144520-39144542 CCAGCCCTTCCCAGAGCCCCGGG - Intronic
1183697597 22:39432036-39432058 GCTGCCGCCCCCACAGCCCCGGG + Intronic
1184731515 22:46373506-46373528 GCTGCCCCTCCCAGAGCGCTGGG - Intronic
1184731520 22:46373535-46373557 GCAGCCTCTCCCAGAGCACTGGG - Intronic
1184861379 22:47174873-47174895 GAAGCCAGTCCCAAGGCCCCTGG - Exonic
1185061273 22:48608075-48608097 CCAGCCCCTCCCACGGCCCCAGG + Intronic
1185061285 22:48608101-48608123 CCAGCCCCTCCCACGGCCCCGGG + Intronic
1185071824 22:48660841-48660863 GCAGACACTCTCAGAGCTCCTGG + Intronic
1203237373 22_KI270732v1_random:18078-18100 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1203251699 22_KI270733v1_random:122114-122136 GCAGCCACACACGGAGCGCCCGG - Intergenic
1203259749 22_KI270733v1_random:167196-167218 GCAGCCACACACGGAGCGCCCGG - Intergenic
1203290421 22_KI270735v1_random:31995-32017 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1203323271 22_KI270737v1_random:90016-90038 AGAGCCACTCTCAGAGACCCTGG + Intergenic
949134918 3:552943-552965 TCAGCCAGTCCTATAGCCCCTGG - Intergenic
949162065 3:893988-894010 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
949190370 3:1243131-1243153 GCAGCCACTCCCAGAGCCCCTGG - Intronic
949671183 3:6400070-6400092 GCAGCCATTCCCAGAGCCCCTGG + Intergenic
949827474 3:8179407-8179429 GCAGCCACTCCCAGAGCGCCTGG + Intergenic
950184218 3:10935096-10935118 CCAGCCAATGCCATAGCCCCAGG - Exonic
950461362 3:13124172-13124194 ACTGCCACTCCCCCAGCCCCTGG - Intergenic
950661641 3:14470427-14470449 CCAGCCACTCCGAGAACCTCTGG - Intronic
950673254 3:14539746-14539768 CCACACATTCCCAGAGCCCCAGG + Intronic
950891386 3:16407928-16407950 GCGGCTACTCCCAGAGTCCCTGG + Intronic
950926528 3:16746708-16746730 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
951298782 3:20970831-20970853 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
951316289 3:21192519-21192541 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
951332297 3:21381882-21381904 GCAGCCACTCCCAGAGCTCCTGG - Intergenic
951663763 3:25099162-25099184 GTAGGCACTCCCAAAGCCCTTGG + Intergenic
951762764 3:26163689-26163711 GCAGCCACTTCCAGAGCCCATGG - Intergenic
951888949 3:27551448-27551470 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
952343530 3:32464729-32464751 GCAGCCACTCCCAGAGCCCCTGG - Intronic
952867204 3:37862043-37862065 GCCGCCTCTCCCAGAGCGCGGGG + Intronic
952896025 3:38079599-38079621 GCAGCCACTCCCAGAGCCCCTGG - Intronic
952953936 3:38545067-38545089 GCAGCCACCCCCAGTGCAGCTGG - Intergenic
953077102 3:39581119-39581141 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
953177223 3:40563370-40563392 GCAGCCACTCCCAGAGCCCCTGG + Intronic
953599406 3:44348342-44348364 GGAGCTGTTCCCAGAGCCCCTGG - Intronic
953656535 3:44859002-44859024 GCAGCCACTCCCAGAGCCCCTGG - Intronic
953825673 3:46249623-46249645 GCAGCCACTCCCAGAGCCCCTGG - Intronic
953834449 3:46330719-46330741 TCAGCCACTCCCAGAGCCCCTGG - Intergenic
953841141 3:46391087-46391109 GCAACCACTCCCAGAGCCCCTGG - Intergenic
953983628 3:47425638-47425660 GCGGCCCCTCCCCCAGCCCCCGG + Intronic
954969235 3:54637802-54637824 GCAGCCACTCCCAGAGCTCCTGG - Intronic
954992756 3:54855234-54855256 GCAGCCAGTCCCAGAGGACACGG - Intronic
955253396 3:57306069-57306091 GCAGCCACTCCCAGAGCCCCTGG + Intronic
955687489 3:61561809-61561831 GCAGCTCCTTCCAGGGCCCCGGG - Intronic
956233469 3:67042000-67042022 GCAGCCACTACCAGAGCTCCTGG - Intergenic
956678064 3:71753815-71753837 GCGGCCACTCCCTGCGCCCTAGG - Intronic
956709247 3:72025379-72025401 GCAGCCACTCCCAGAGACCCTGG + Intergenic
957059868 3:75473351-75473373 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
957079430 3:75623723-75623745 GCTGCCACGCCCTGTGCCCCTGG - Intergenic
957155083 3:76535971-76535993 GCAGCCACTTCTAGGGCCCCTGG - Intronic
957255041 3:77825739-77825761 CCAGCCCCTCCCAGTGCTCCTGG - Intergenic
957295266 3:78326193-78326215 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
957317279 3:78586466-78586488 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
957394395 3:79620204-79620226 GCAACCACTCCCAGAGCCCCTGG + Intronic
957451464 3:80387271-80387293 GCAACCACTCCCAGAGCCCCTGG + Intergenic
957734836 3:84191121-84191143 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
957904819 3:86541702-86541724 GCAGCCTCTCCCAGAGCTCCTGG - Intergenic
958182917 3:90083455-90083477 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
958421987 3:93940191-93940213 TCAGTCACTCCCAGAGCCCCTGG + Intronic
958676783 3:97276304-97276326 GCAGCCACTCCCAGAGCCCCTGG - Intronic
958751961 3:98202256-98202278 TCTGCCAGTCCCAGAGCGCCAGG - Intergenic
959288322 3:104443238-104443260 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
959485746 3:106926049-106926071 GCAGCCACTCCCAGAGGCCCTGG - Intergenic
959543666 3:107569961-107569983 GCAGCCACTCCCAGAGCCCCTGG - Intronic
959972235 3:112420884-112420906 GCAGCCACTCCCAGAGGCCCTGG - Intergenic
960282845 3:115796825-115796847 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
960310087 3:116108638-116108660 GCAGCCACTCCCATAGCTTCTGG - Intronic
960672323 3:120165628-120165650 TCAGCCACCACCAGAGCCACAGG - Exonic
961164731 3:124755872-124755894 GCAGCCACTCCCAGAGCCTCTGG - Intergenic
961293536 3:125866086-125866108 ACAGCCACTCCCAGAGCCCCTGG + Intergenic
961384857 3:126517659-126517681 GCGGCCCCTCCCAGAGAACCGGG - Exonic
961386457 3:126525738-126525760 GCAGACACTCCCCGGGACCCAGG - Intronic
961609207 3:128123423-128123445 GGCGCCCCTCCCCGAGCCCCTGG + Intronic
961711595 3:128832511-128832533 GCAGCCCCTCCCAGAGCCCCTGG - Intergenic
961712686 3:128839502-128839524 GCTGCCGCTCCTAAAGCCCCTGG - Intergenic
961730617 3:128962096-128962118 GCAGCCACTCCCAGAGCCCCTGG + Intronic
961773066 3:129264311-129264333 GAAACCACTCCTAGAGCTCCTGG - Intronic
961881075 3:130061663-130061685 GCAGCTGCTCCCAGAGCCCCTGG + Intergenic
961893685 3:130150460-130150482 GGCACCACTCCCAGAGCCCAAGG - Intergenic
962022158 3:131512427-131512449 ACAGCCACTCCCAGAGCCCCTGG - Intergenic
962205596 3:133431519-133431541 GCAGCCACTCCCAGAGCCCCTGG + Intronic
962660665 3:137597864-137597886 GCAGCCACTCCCGGAGCCCCTGG + Intergenic
963058653 3:141207354-141207376 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
963111809 3:141694606-141694628 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
963319775 3:143799673-143799695 GCAGCCACTCCCAGAGCCGCTGG + Intronic
963425248 3:145115370-145115392 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
963456635 3:145554495-145554517 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
963468640 3:145712788-145712810 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
963520473 3:146355938-146355960 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
963521652 3:146364443-146364465 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
963644474 3:147896360-147896382 GACACCACACCCAGAGCCCCAGG + Intergenic
963663372 3:148154041-148154063 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
963684361 3:148416738-148416760 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
964067924 3:152599833-152599855 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
964163334 3:153671850-153671872 GCTGCCACCCCCACAGCCCTTGG - Intergenic
964300220 3:155278502-155278524 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
964906489 3:161725181-161725203 GCAACCACTCCCAGATCCCCTGG - Intergenic
964940929 3:162157459-162157481 GCCACCACTTCCAGAGCCCCTGG - Intergenic
964983661 3:162714792-162714814 GCAGTCACTTCCAGTGCCCCTGG + Intergenic
964984840 3:162725843-162725865 GCAGCCACTTTCAGAGCCCCTGG - Intergenic
965070355 3:163909933-163909955 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
965105203 3:164345439-164345461 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
965262622 3:166504105-166504127 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
965286706 3:166827423-166827445 GAAGCTACTCCCAGAGCCTCTGG - Intergenic
965300655 3:167001534-167001556 GCACACACTGCCTGAGCCCCAGG - Intergenic
965336358 3:167433605-167433627 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
965624854 3:170675842-170675864 GCAGCCACTCCCAGAGCCCCTGG - Intronic
965626283 3:170686644-170686666 GCAGCCACTCCCAGAGCCTCTGG - Intronic
965640009 3:170821278-170821300 GCAGCCACTCCCAGAGCCCCTGG - Intronic
965713438 3:171578804-171578826 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
965861938 3:173159228-173159250 GCAGCCACTCTCAGAGCCCATGG - Intergenic
966066867 3:175830104-175830126 GCAACCACTCCCAGAGCCCCTGG + Intergenic
966085460 3:176063725-176063747 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
966105059 3:176324943-176324965 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
966232818 3:177669159-177669181 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
966279336 3:178209922-178209944 GCAGCCACTCCTAGAGCCCCTGG + Intergenic
966398418 3:179524253-179524275 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
966498020 3:180602473-180602495 GCAGCCACTACCGCAGCCCCGGG + Intronic
967005326 3:185377852-185377874 GCAGCCACTCCCAGAGCCCCTGG - Intronic
967118066 3:186360092-186360114 CCGGACACTCCCAGAGGCCCAGG - Intronic
967152153 3:186660405-186660427 GCAGCCACTCCCAGAGCCCCTGG + Intronic
967212137 3:187178849-187178871 GCAGCCACTCCCAGAGCCCCTGG - Intronic
967244139 3:187469591-187469613 GCAGCCACTCCCAGAGCTCCTGG - Intergenic
967496252 3:190146895-190146917 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
967561410 3:190922495-190922517 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
967624622 3:191669808-191669830 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
967643800 3:191898678-191898700 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
967658079 3:192074405-192074427 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
967740512 3:192998073-192998095 GCAGCCACTCCCAGCTTCCCTGG + Intergenic
968437291 4:600345-600367 TCAGCCACACACAGAGACCCAGG - Intergenic
968477360 4:818285-818307 CCAGCCAGGCCCAGGGCCCCTGG - Intronic
968632561 4:1659562-1659584 GCAGCTACTCCCAGTGGCACTGG + Intronic
968649235 4:1753857-1753879 GCCGCCACCGCCAGAGACCCAGG + Intergenic
968943376 4:3651055-3651077 GAGGCCACTTCCAGAGCTCCTGG - Intergenic
968993410 4:3929768-3929790 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
969003783 4:4003536-4003558 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
969213907 4:5708360-5708382 GCAGCCACCCCGGGATCCCCAGG - Exonic
969654069 4:8486102-8486124 GCAGCCACTCCCAGAGCCCCTGG - Intronic
969749084 4:9096649-9096671 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
970029203 4:11657053-11657075 GCAGCCACTCTCAGAGCCCCTGG - Intergenic
970042116 4:11808663-11808685 GCAGCCATTCCCAGAGCCCCTGG + Intergenic
970087571 4:12366152-12366174 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
970256393 4:14173850-14173872 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
970532766 4:17000052-17000074 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
970854022 4:20633618-20633640 GCAGCCACTCCAAGAGCTCCTGG - Intergenic
971123157 4:23725346-23725368 GCAGCCACTCCCAGAGGCCCTGG - Intergenic
971180591 4:24325600-24325622 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
971200164 4:24503397-24503419 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
971552678 4:27976354-27976376 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
972561327 4:40231594-40231616 GCAGCTTCTCCCAGGCCCCCAGG + Intronic
973751153 4:54022194-54022216 GCAGCCACTCCCAGAGCCCCTGG + Intronic
974428368 4:61767612-61767634 GCAGCCACTCCCAGAGCTCCTGG - Intronic
974766241 4:66349865-66349887 GCATCCAATACCAGAGCACCAGG + Intergenic
974903805 4:68033003-68033025 GCAACCACTCCCAGAGCCCCTGG + Intergenic
975152152 4:71033918-71033940 GCTGCCGCTCCTAAAGCCCCTGG + Intergenic
975865063 4:78717182-78717204 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
976558596 4:86476977-86476999 GCAGCCACTCCCAGAGCCCCTGG + Intronic
976696566 4:87924255-87924277 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
976884541 4:89968116-89968138 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
977010346 4:91626477-91626499 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
977012896 4:91657946-91657968 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
977062481 4:92274814-92274836 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
977075175 4:92442285-92442307 GGAGCCACTCTCAGAGCCCCTGG - Intronic
977198401 4:94087948-94087970 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
977217128 4:94296539-94296561 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
977225316 4:94386792-94386814 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
977446411 4:97137925-97137947 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
978001091 4:103557087-103557109 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
978031515 4:103943528-103943550 GAAGCCACTCCCAGAGGCCCTGG + Intergenic
978303200 4:107293744-107293766 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
978438639 4:108711414-108711436 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
978625829 4:110684144-110684166 GGAGCCACTCCCAGTGCTGCGGG - Intergenic
978788706 4:112638268-112638290 GCAGCCTCTCTCAGTGGCCCAGG - Intronic
979054593 4:115978977-115978999 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
979146647 4:117254487-117254509 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
979171382 4:117603633-117603655 GCAGCTACTTCCAGAGCCCCTGG - Intergenic
979379968 4:119996308-119996330 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
979465171 4:121028725-121028747 ACAGCCACTTCCACAGTCCCAGG - Intergenic
979850281 4:125564960-125564982 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
979895133 4:126148460-126148482 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
980003323 4:127514770-127514792 GCAGCCACTCCCAGAACCCCTGG - Intergenic
980284976 4:130769747-130769769 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
980388955 4:132120587-132120609 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
980472411 4:133267016-133267038 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
980527897 4:134014561-134014583 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
980575606 4:134681230-134681252 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
980611750 4:135170614-135170636 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
980903967 4:138930258-138930280 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
981040274 4:140215881-140215903 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
981070006 4:140524453-140524475 GCAGAGACGCCCAGAGCCCTGGG + Intronic
981525239 4:145701488-145701510 GCAGCCACTCCCAGAGCCCCTGG + Intronic
981539751 4:145835132-145835154 GCAGCCACTCCCAGAGCCCCTGG + Intronic
982083939 4:151815926-151815948 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
982318837 4:154058667-154058689 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
982396690 4:154922162-154922184 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
982497080 4:156106790-156106812 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
982535474 4:156602669-156602691 GCAGCCACTCCCAGAGACCCTGG + Intergenic
983023902 4:162711488-162711510 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
983055517 4:163095475-163095497 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
983345587 4:166522909-166522931 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
983360434 4:166718687-166718709 GCAGCCACTCCCACAGCCCCTGG + Intergenic
983414682 4:167439128-167439150 GCAGCCACTCCCACAGCCCCTGG - Intergenic
983448085 4:167878638-167878660 GCAGCCACTCCCAGAGATGCTGG + Intergenic
983452364 4:167925281-167925303 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
983659600 4:170118841-170118863 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
983689470 4:170450893-170450915 GAAGCCACTCCCAGAAGTCCAGG + Intergenic
983707702 4:170679879-170679901 GCAGCCACTCCCAGAATCCCTGG + Intergenic
983805763 4:171989354-171989376 GCAGCCACTCCCAGAGCCCCTGG - Intronic
983883730 4:172959693-172959715 GCAGCCACTCCCAGAGCCCCTGG - Intronic
984165329 4:176298172-176298194 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
984322216 4:178209509-178209531 GCAGCCACTCCCGGAGCCCCTGG + Intergenic
984365033 4:178787601-178787623 GAAACCACTCACAGAGCCCTGGG - Intergenic
984393587 4:179168213-179168235 ACAGCCACTGCCAGAGCCCCTGG - Intergenic
984411756 4:179405605-179405627 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
984437290 4:179722833-179722855 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
984486085 4:180371750-180371772 GCAGCCACTTACACAGTCCCAGG - Intergenic
984700699 4:182816909-182816931 GCAGCCACTCTCAGAGACCCTGG + Intergenic
984806820 4:183758722-183758744 GAAGCCACCCCCAAAACCCCAGG + Intergenic
984915782 4:184723064-184723086 GCTGTCACTCCCAGTGCCACTGG - Intronic
984977789 4:185244975-185244997 GCAATCAATCCCACAGCCCCAGG - Intronic
985057371 4:186047521-186047543 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
985078980 4:186245432-186245454 GCTGCCACTCCCAGAGCCCCTGG - Intronic
985389841 4:189482787-189482809 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
985435750 4:189928240-189928262 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
985582381 5:705176-705198 GTAGCCACTTCCAGAGCCCCTGG + Intergenic
985760154 5:1744782-1744804 GCACCCATTCCCAGGGCCCCAGG - Intergenic
985816196 5:2130076-2130098 GCAGCCTCTGCAGGAGCCCCGGG - Intergenic
985816541 5:2132074-2132096 GCTGCCACACCCAAAGCTCCAGG - Intergenic
985843865 5:2329895-2329917 GCAGCCCCTCCCTCTGCCCCAGG + Intergenic
986004871 5:3659176-3659198 CCATCCAGACCCAGAGCCCCAGG - Intergenic
986184502 5:5423002-5423024 GCAGCACCTCCCGGGGCCCCGGG + Intronic
986193563 5:5517942-5517964 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
986368951 5:7061634-7061656 GCAGCCACTCCCAGAACCCCTGG - Intergenic
986388906 5:7265972-7265994 GAAGCCACTCCCAGAGCCCCTGG + Intergenic
986555013 5:9001869-9001891 GAAGCCACTCCCAGAGCCCCTGG - Intergenic
986905801 5:12492188-12492210 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
986919561 5:12665863-12665885 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
987282066 5:16422401-16422423 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
987486866 5:18536062-18536084 GCTGCCACTCCCAGAGCCCGTGG + Intergenic
987487530 5:18540696-18540718 GCAGACACTCCCAGAGCCCCTGG + Intergenic
987498094 5:18672182-18672204 GCTGCCACTCCCAGAGCCCGTGG - Intergenic
987711424 5:21503989-21504011 GCAGACACACCCAGAGACCAAGG + Intergenic
987755855 5:22097232-22097254 GCAGCCACTCCCAGAGCCCCTGG + Intronic
988199127 5:28048026-28048048 GAAGGCACTCCCAGAGCCCCTGG + Intergenic
989297070 5:39841292-39841314 GGATCCACTCCCAGAGCTCAGGG - Intergenic
989615129 5:43331262-43331284 GCAGCCACTCCCAGAGTCCCTGG - Intergenic
989688874 5:44118058-44118080 GCAGCCACTCCCAAAACCCCAGG - Intergenic
990565095 5:57020304-57020326 GCAGCCGCTCCCAGAGTCCCTGG - Intergenic
991043696 5:62201191-62201213 GCAGCCACCAGCAGAGTCCCAGG + Intergenic
991761789 5:69923106-69923128 GCAGACACACCCAGAGACCAAGG + Intergenic
991785540 5:70194994-70195016 GCAGACACACCCAGAGACCAAGG - Intergenic
991841017 5:70798155-70798177 GCAGACACACCCAGAGACCAAGG + Intergenic
991877985 5:71195384-71195406 GCAGACACACCCAGAGACCAAGG - Intergenic
992394692 5:76359741-76359763 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
992451972 5:76883707-76883729 GCAGCCACTCCCGGAGCCCCTGG - Intronic
992563323 5:77973396-77973418 GCCGCCACTCCCAGAGGAGCCGG - Intergenic
992960859 5:81955645-81955667 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
993057557 5:82999804-82999826 GCAGCCAATACCTGAGACCCTGG - Intergenic
993192741 5:84700866-84700888 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
993207070 5:84895334-84895356 GCAGCCTGTCTCAGAGCCCAAGG + Intergenic
993836732 5:92826362-92826384 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
993901580 5:93587695-93587717 CCAGCCACTGCCTGAGCCCCTGG - Intronic
994126082 5:96170212-96170234 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
994295174 5:98081452-98081474 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
994375755 5:99014631-99014653 GCAGTCACTTCCAGAGCCCCTGG - Intergenic
994532518 5:100987578-100987600 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
994775711 5:104034004-104034026 GCAGCTACTCCCAGAGCCCCTGG + Intergenic
994778919 5:104067511-104067533 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
994989582 5:106980767-106980789 GCAGACACTCCCAGAGCCCCTGG + Intergenic
995125134 5:108571780-108571802 GCAGCCAGTTCCAGCACCCCTGG - Intergenic
995296700 5:110532228-110532250 GCAGCCACTCCCAGAGCCCCTGG + Intronic
995769411 5:115652918-115652940 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
995899338 5:117049688-117049710 GCAGCAACTCCCAGAGCCCCTGG - Intergenic
996052645 5:118950531-118950553 GCAGCCACTCCCAGAGCCCCTGG - Intronic
996203233 5:120700914-120700936 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
996344793 5:122476928-122476950 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
996358593 5:122622191-122622213 GCAGCCACTCCCGGGGTCCCTGG - Intergenic
996509928 5:124306179-124306201 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
996528080 5:124499441-124499463 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
996574969 5:124969924-124969946 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
996745418 5:126842882-126842904 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
996862475 5:128082974-128082996 GCAGCCGCTTCCGGAGCCGCGGG - Intergenic
997678833 5:135734998-135735020 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
997746429 5:136303700-136303722 GTAGCCACTTCCAGAGCCCCTGG + Intronic
997769652 5:136542936-136542958 GAAGCCACTCCCAGAGCCCCTGG - Intergenic
997772615 5:136568671-136568693 GCAGCCACTCCTAGAGCCCCTGG - Intergenic
997826756 5:137113358-137113380 GGAGCGACTCCCAGGGCCCTGGG + Intronic
998199526 5:140108243-140108265 GCTGCCACTGCCACAGCTCCAGG + Intronic
998204046 5:140146466-140146488 CCAGCCTCACCCAGAGCCCGAGG - Intergenic
998693675 5:144614661-144614683 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
998995417 5:147865662-147865684 ACACCCACTCCCAGAGCCCCTGG + Intergenic
998996370 5:147872296-147872318 GCAGCCACTCGCAGAGCCCCCGG - Intronic
999618839 5:153453033-153453055 GCAGCTACTCCCAGAGCCCCTGG - Intergenic
999730810 5:154475753-154475775 CCAGCCACTCCTGAAGCCCCGGG - Exonic
1000439749 5:161250879-161250901 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1000519380 5:162278713-162278735 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1000606961 5:163336411-163336433 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1000885291 5:166742415-166742437 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1000935613 5:167301210-167301232 GCATCCACTCCCAGAGCCCCTGG - Intronic
1001331424 5:170765357-170765379 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1002186142 5:177455658-177455680 CCAGCCTCTCGCAGAGGCCCCGG - Intronic
1002537421 5:179884838-179884860 GCCCCCACTCCCCCAGCCCCTGG - Intronic
1002610932 5:180418049-180418071 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1002641129 5:180631079-180631101 GCATCCACTCCCAGCCACCCTGG - Intronic
1003430137 6:6031106-6031128 GCAGCCGCTCCCAGAACCCCTGG - Intergenic
1003965428 6:11248352-11248374 GCAGTCACTCCCTGAGCATCAGG - Intronic
1004106294 6:12669764-12669786 ACAGCCACTTCCAGATCCCCTGG + Intergenic
1004283492 6:14300275-14300297 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1004507968 6:16262316-16262338 GCAGCCACTCCCAGCGCCCCTGG - Intronic
1004575251 6:16888343-16888365 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1004708573 6:18148421-18148443 GCAGCCACGCCCATCTCCCCAGG - Intronic
1004768545 6:18757389-18757411 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1004837031 6:19541291-19541313 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1005014630 6:21364831-21364853 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1005786545 6:29250530-29250552 AAAGCCACTCCCAGAGCCCCTGG - Intergenic
1005987753 6:30884746-30884768 GCCCCCACCCCAAGAGCCCCAGG - Intronic
1006324882 6:33346219-33346241 GCAGTCACTCCCAGAGCTCTGGG + Intergenic
1006438318 6:34038529-34038551 GCCGCCACACCCTGAGACCCTGG + Intronic
1006581543 6:35080458-35080480 GCAGCCGCTCCCCGAGCCCTCGG + Intronic
1006635846 6:35460597-35460619 GCAGTCACTCCTAGAGCGGCAGG + Exonic
1006860789 6:37170469-37170491 ACAGCCACAGCCACAGCCCCAGG + Exonic
1007142637 6:39591188-39591210 GGAGCCCGTCCCAGCGCCCCAGG - Intronic
1007350770 6:41272024-41272046 GCAGCAACTACAAGAGGCCCTGG - Intronic
1007708092 6:43803669-43803691 ACAGCCACAGCCACAGCCCCAGG - Intergenic
1007733239 6:43964722-43964744 GCAGCTCCTCGCAGAGCACCAGG - Intergenic
1007747988 6:44054977-44054999 CCAGCCTCTCCCTGAGCCCAAGG + Intergenic
1007813589 6:44504051-44504073 GCAGCCCTTCCCTGAGCCCCTGG + Intergenic
1008476557 6:51940570-51940592 GAAGCCACTTCCAGAGCCCCTGG + Intronic
1008850183 6:56014139-56014161 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1009269846 6:61602489-61602511 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1009359381 6:62793891-62793913 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1009379169 6:63007684-63007706 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1009464362 6:63952293-63952315 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1010071695 6:71751871-71751893 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1010571070 6:77475167-77475189 GCAGCCACTGCCCAGGCCCCAGG + Intergenic
1010586668 6:77663879-77663901 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1010662342 6:78585781-78585803 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1010826884 6:80485761-80485783 GCAGCCACTCCCAGAGCTCCTGG - Intergenic
1010829662 6:80513629-80513651 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1010841286 6:80651121-80651143 GAAGCCACTCCCAGAGCCCCTGG - Intergenic
1010894517 6:81348461-81348483 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1011367869 6:86601694-86601716 GCAGCCACTCCCAGAGTACCTGG - Intergenic
1011770913 6:90673536-90673558 GCAGCCAATCCCAGAGCCCCTGG - Intergenic
1012014364 6:93833402-93833424 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1012066515 6:94557268-94557290 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1012315852 6:97781985-97782007 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1012443914 6:99289267-99289289 GAAGCCTCTCCCAGAGGCCCTGG + Intronic
1012689602 6:102295312-102295334 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1013407859 6:109859079-109859101 GCAGCCACTCCCAGGGTCCCTGG - Intergenic
1013808054 6:114015636-114015658 GCAGCCCCTCTCAGAGCCCCTGG - Intergenic
1013843651 6:114425647-114425669 GCAGCCACTCCCAGAGCCCCGGG - Intergenic
1013883524 6:114933886-114933908 CAAGCCAATCCCAGAGCCCCGGG - Intergenic
1014360131 6:120465590-120465612 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1014396094 6:120927576-120927598 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1014454842 6:121623763-121623785 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1014555877 6:122842215-122842237 GCAGCCACTCCCACAGCCCATGG + Intergenic
1014612115 6:123559020-123559042 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1014614643 6:123585612-123585634 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1014718925 6:124894423-124894445 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1014793960 6:125705185-125705207 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1014891572 6:126851140-126851162 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1015165245 6:130194730-130194752 GCAACCACTCCCAGAGCCCATGG + Intronic
1015266766 6:131297842-131297864 ACAGCCACTCCCAGAGCCCCTGG + Intergenic
1015269685 6:131325789-131325811 GCAGCCACTCCCGGAGCCCCTGG + Intergenic
1015271403 6:131341267-131341289 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1015278183 6:131405199-131405221 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1015288017 6:131507606-131507628 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1015323860 6:131904072-131904094 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1015410237 6:132886010-132886032 GCAATCACTCACAGAGCCTCAGG + Intergenic
1015801350 6:137064649-137064671 GCAGCCACTCCCAGAGACCCTGG - Intergenic
1015846062 6:137522371-137522393 CCAGTCACTGCTAGAGCCCCTGG + Intergenic
1016044356 6:139466113-139466135 GCGGACATTCCCAGAGCACCTGG + Intergenic
1016248890 6:142018194-142018216 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1016371604 6:143380404-143380426 GCATCCACTCCTAGTGCCTCAGG - Intergenic
1016426578 6:143941969-143941991 GCAGCCGCTGCCAGAGTCCCTGG - Exonic
1016518834 6:144925558-144925580 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1016535731 6:145106473-145106495 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1016650263 6:146453739-146453761 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1016853301 6:148642191-148642213 CACGCCACTCCCAGAGCCCCTGG + Intergenic
1017269842 6:152492600-152492622 GAAGCCACTCCCAGAGCCCCTGG + Intronic
1017389531 6:153923871-153923893 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1017779306 6:157703971-157703993 GCAGCCACTTCTAGAGCCCCTGG - Intronic
1017922805 6:158886356-158886378 ACTGCCACTCCTAAAGCCCCTGG - Intronic
1018084465 6:160289895-160289917 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1018291789 6:162298862-162298884 GCAGCACCTCCCAGAGGTCCAGG - Intronic
1018420240 6:163634781-163634803 GCAGCAACTTCCAGAGCAGCAGG - Intergenic
1018495376 6:164342057-164342079 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1018521442 6:164655475-164655497 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1018798552 6:167205854-167205876 GCAGCCTCTCCAAGTGCTCCTGG - Intergenic
1018814157 6:167318311-167318333 GCAGCCTCTCCAAGTGCTCCTGG + Intergenic
1018860317 6:167706584-167706606 GCAGAGACTCTCAGGGCCCCAGG + Intergenic
1019190975 6:170250595-170250617 GCAGCTGCTCCCAGAGCCTTTGG - Intergenic
1019523848 7:1472065-1472087 GCAGCCACCTCCAGCTCCCCTGG + Intronic
1019660903 7:2223513-2223535 CCAAGCACTCCCGGAGCCCCGGG + Intronic
1020316078 7:6906175-6906197 GCAGCTGCTCCCAGAGCCCTTGG + Intergenic
1020323918 7:6959991-6960013 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1020532687 7:9356744-9356766 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1020541117 7:9461879-9461901 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1020551484 7:9611752-9611774 TCAGCCCCTCCCAAGGCCCCAGG + Intergenic
1020794245 7:12661949-12661971 GCAGCCACTCCCAGAGGCCCTGG + Intergenic
1021393655 7:20122989-20123011 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1021429874 7:20547835-20547857 GCAACCACTCCCAGAGCCCCTGG + Intergenic
1021620930 7:22550368-22550390 GCAGCCACCTTCAGAGCGCCAGG + Intronic
1021634366 7:22677124-22677146 GAAGCCTCTCTCAGAGCCTCTGG + Intergenic
1021637345 7:22705630-22705652 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1021660654 7:22915505-22915527 GCAGCCACTCGCAGAATCCCTGG + Intergenic
1021810690 7:24398663-24398685 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1021977867 7:26027511-26027533 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1022138553 7:27472307-27472329 GCAGCCCCTTCCAGAGACCAGGG + Intergenic
1022372901 7:29787233-29787255 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1022447431 7:30481618-30481640 GCAGCCACTGCTAGAGCCCCTGG + Intergenic
1022572764 7:31470351-31470373 CCAGCCACTCCCAGAGCCCCTGG - Intergenic
1022709099 7:32834766-32834788 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1022710016 7:32841227-32841249 GCAGCCACTCCCGGAGCCCCTGG - Intergenic
1022854682 7:34303216-34303238 GCAGCCACTCCCAGAACCCCTGG - Intergenic
1023698857 7:42873931-42873953 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1023845590 7:44118251-44118273 CCAACCACACCCAGAGTCCCTGG - Intronic
1023872056 7:44268639-44268661 GCAGCCATTCCCAGATCCACAGG + Intronic
1024478393 7:49838563-49838585 GCAGCCTGTCCCAGAGACACAGG - Intronic
1024504851 7:50153687-50153709 GTGCCCCCTCCCAGAGCCCCAGG - Intronic
1024739221 7:52336969-52336991 GCAGTCACTCCCAGAGCCCCTGG - Intergenic
1024805615 7:53135902-53135924 AGAGCCACTCTCAGAGGCCCTGG + Intergenic
1025321287 7:58096528-58096550 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1025474305 7:60900507-60900529 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1025480457 7:60976572-60976594 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1025488455 7:61081185-61081207 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1025512698 7:61589367-61589389 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1025551508 7:62255687-62255709 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1025557249 7:62324413-62324435 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1025837573 7:65109192-65109214 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1026955835 7:74376027-74376049 GCAGCCGCTCCCGTAGCCGCAGG - Exonic
1026973014 7:74479354-74479376 CCACCCACTCCCACAGCCTCTGG + Intronic
1026995407 7:74612714-74612736 GCAGCCTCCCCCAGCGGCCCAGG + Intergenic
1027158345 7:75784315-75784337 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1027354452 7:77342084-77342106 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1027851974 7:83462051-83462073 GCAGCCATTCCCAGAGCCCCTGG + Intronic
1028589880 7:92483112-92483134 GCAGCCAATCCCAGAGCCCCTGG - Intergenic
1028670538 7:93396317-93396339 GCAGCCACTTCTAGAGCCCCTGG + Intergenic
1028690205 7:93642247-93642269 GCAGCCACTTCCAGAGCCCCTGG + Intronic
1029471362 7:100756576-100756598 GCAGCAACTCAGAGAGACCCAGG - Intronic
1029500238 7:100924556-100924578 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1029845820 7:103411286-103411308 GCAGTTACTCCCAGAGCTCTGGG + Intronic
1029869965 7:103680342-103680364 TCAGGGAGTCCCAGAGCCCCTGG - Intronic
1030312325 7:108081208-108081230 GCAGCCACACACAGAGCAACTGG - Intronic
1030441656 7:109595350-109595372 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1030751472 7:113236902-113236924 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1031004695 7:116457870-116457892 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1031296644 7:120011275-120011297 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1031355163 7:120780468-120780490 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1031400013 7:121317962-121317984 GCAGACACTCCCAGAGCCCCTGG + Intergenic
1031525619 7:122819307-122819329 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1031685875 7:124731425-124731447 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1031727902 7:125262226-125262248 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1031777373 7:125920000-125920022 GCAGCCACTCCCAGAGCCCTTGG + Intergenic
1032192375 7:129772294-129772316 GCAGCGGCTCCCAGATGCCCGGG - Intergenic
1032265084 7:130364977-130364999 GGAGCCAAACCCTGAGCCCCCGG - Intronic
1032418409 7:131757086-131757108 GCAGCTACTCCCAGGTTCCCAGG - Intergenic
1033084746 7:138331411-138331433 GCAGCCACTCTCAGAGCCCCTGG + Intergenic
1033211548 7:139463678-139463700 GCAGCCAACCCCAGAGTCCCTGG + Intronic
1033675920 7:143540546-143540568 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1033695914 7:143788893-143788915 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1033909442 7:146246703-146246725 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1034084804 7:148313374-148313396 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1034112104 7:148547212-148547234 GCGGCCACTCTCAGAGCCCATGG + Intergenic
1034334155 7:150309740-150309762 ACAGCCACTTCTAGGGCCCCTGG + Intronic
1034592366 7:152152474-152152496 GCTGGCACTCACATAGCCCCTGG + Intronic
1034941950 7:155236495-155236517 CCAGCCTTTCCCAGAGTCCCCGG + Intergenic
1035036320 7:155897590-155897612 GCAGAGCCTCCCTGAGCCCCTGG - Intergenic
1035682956 8:1501874-1501896 GCAGCCTCTCGCAGGGCCCTTGG - Intronic
1035741372 8:1930661-1930683 CCAGCCCCTCCCAGAGCCTGGGG + Intronic
1035880638 8:3241540-3241562 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1035887076 8:3302959-3302981 GCAACTGCTCCCAGAGCCCCAGG + Intronic
1036070897 8:5439965-5439987 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1036281511 8:7404822-7404844 GCAGCCATTCCCACAGCCCCTGG + Intergenic
1036339960 8:7906750-7906772 GCAGCCATTCCCACAGCCCCTGG - Intergenic
1036372156 8:8170993-8171015 GCAGCCACTCCTAGAGCCCCTGG + Intergenic
1036472303 8:9062759-9062781 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1036639521 8:10573655-10573677 GCAGCCACTCCCACAGCCCCTGG + Intergenic
1036642458 8:10592875-10592897 GCAGCCCCACCCAGAGCACAGGG - Intergenic
1036687109 8:10919031-10919053 GCAGCCCCTCCCACTGCCCTTGG + Intronic
1036748057 8:11424189-11424211 GCATCCACACCCAGGGCCCCTGG + Exonic
1036807694 8:11846811-11846833 GAGGCCTCTCCCAGAGCCTCTGG - Intronic
1036878745 8:12494648-12494670 GCAGCCACTCCTAGAGCCCCTGG - Intergenic
1037788964 8:21919924-21919946 GCCGCCCGTCCCGGAGCCCCGGG + Intronic
1038002636 8:23404250-23404272 GCGGCCACTCCCAGGGCCAGAGG + Intronic
1038146816 8:24904951-24904973 GGATTCCCTCCCAGAGCCCCCGG + Intergenic
1039347620 8:36725415-36725437 GCAGCCACTACCAGATGTCCAGG - Intergenic
1039498972 8:38002000-38002022 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1040360373 8:46659008-46659030 GCATGCAGTCCCAGAGCCCGGGG + Intergenic
1040569136 8:48592541-48592563 GCAGCCCATCCCAGAGCAGCAGG - Intergenic
1040648049 8:49421885-49421907 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1041651814 8:60309824-60309846 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1042453586 8:68975557-68975579 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1042707398 8:71677300-71677322 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1043353642 8:79389429-79389451 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1043597424 8:81901861-81901883 GCAGCCACTCCCAGAGTCCCTGG - Intergenic
1043717869 8:83508465-83508487 GCAGCCACTACCAGAGCCCCTGG - Intergenic
1043720932 8:83546356-83546378 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1043837764 8:85065359-85065381 GCAGCCACTTCCAAAGCCCCTGG + Intergenic
1044148488 8:88745539-88745561 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
1044258589 8:90093528-90093550 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1044417112 8:91950354-91950376 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1044922021 8:97177461-97177483 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1044925188 8:97203305-97203327 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1045007434 8:97928568-97928590 CCAGCCAAGCCCTGAGCCCCAGG - Intronic
1045077914 8:98590457-98590479 TCCGCCACTCCCAGAGCCCCTGG - Intronic
1045197552 8:99946256-99946278 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1045644809 8:104288320-104288342 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1046074936 8:109303197-109303219 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1046294146 8:112198209-112198231 GCAGCTACTCCCAGAGCCCCTGG + Intergenic
1046386312 8:113512837-113512859 GCAGCCACTACCAGAGCCCCTGG - Intergenic
1046440042 8:114243723-114243745 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1046443273 8:114284375-114284397 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1046512116 8:115214612-115214634 GCAGCCACTCCCAGAGTCCCTGG + Intergenic
1046559307 8:115816994-115817016 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1047829517 8:128615232-128615254 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1047856402 8:128916805-128916827 GCAGCCACTCTCAGAGCCCCTGG + Intergenic
1048097635 8:131312591-131312613 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1048135495 8:131743107-131743129 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1048168406 8:132083561-132083583 GCAGCCACTCCCAGAGCCCTTGG - Intronic
1048585393 8:135770465-135770487 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1048616948 8:136085593-136085615 TCACCCACTCCCACAGCCCCTGG + Intergenic
1048728393 8:137411599-137411621 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1048764210 8:137828147-137828169 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1048838760 8:138546620-138546642 GTAGCCTAACCCAGAGCCCCAGG + Intergenic
1048901790 8:139044795-139044817 GCAGTCGGTCCCAGAGCCCCAGG - Intergenic
1049372517 8:142274603-142274625 CCCGCCACTCCCAGAGCCCTAGG + Intronic
1049401576 8:142429969-142429991 GCTGCCACTCCCAGTGCCTATGG + Intergenic
1049587565 8:143439069-143439091 GCAGCCAGTTCCAGAGCCAGTGG - Intronic
1049594674 8:143477850-143477872 CCAGCCACTCACAGAGCCTCTGG + Intronic
1049602718 8:143515344-143515366 GCAGCCCCTCGCTGCGCCCCAGG - Intronic
1049671546 8:143872287-143872309 GCTGCCACTCCTAGAGGCCCAGG - Exonic
1049868790 8:144957583-144957605 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1050117632 9:2277953-2277975 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1050140506 9:2511820-2511842 GCAGCCACTCCCAGAGCCACTGG + Intergenic
1050258076 9:3814475-3814497 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1050677345 9:8071210-8071232 GCAGCCAGTGCCAAAGCCCAGGG - Intergenic
1050896101 9:10887153-10887175 GCAGCCACTCCCAGAACGCCTGG + Intergenic
1051052653 9:12950708-12950730 GCAGCCACTCCCAGCTTCCCTGG + Intergenic
1051371371 9:16362136-16362158 GCTGCCTCTCCCAGGGCCCTGGG + Intergenic
1051849256 9:21489025-21489047 GCAGCCACTCCCAGAGTCCCTGG - Intergenic
1052163110 9:25290059-25290081 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1052191859 9:25671313-25671335 GCAGCCGCTCCCAGAACCCCTGG + Intergenic
1052653362 9:31328801-31328823 GCAGCTACTCCCAGAGCCCCTGG + Intergenic
1052720613 9:32167835-32167857 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1053078431 9:35154556-35154578 GCAGCCACTCCCACAGCCCCTGG - Intergenic
1053122110 9:35555299-35555321 GCATCCACTCCCCGAGCCACTGG + Exonic
1053698771 9:40665646-40665668 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1053944777 9:43295878-43295900 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1054310060 9:63465047-63465069 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1054408848 9:64789199-64789221 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1054442007 9:65273013-65273035 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1054488276 9:65748484-65748506 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1054807459 9:69408076-69408098 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1055233091 9:74088050-74088072 GTAGCCACTCCCAGAGCCCCTGG + Intergenic
1055347687 9:75355104-75355126 GCAGCCACTCCCAGAACCCCTGG - Intergenic
1055375902 9:75648166-75648188 GCAGCTGCTGCCAGGGCCCCAGG - Intergenic
1055626751 9:78183194-78183216 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1055810076 9:80139798-80139820 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1055881774 9:81011394-81011416 GCAGCCACTCCCAGAGCTCCTGG + Intergenic
1056044709 9:82704035-82704057 GCAGCCACTCCCGGAGCCCCTGG - Intergenic
1056061186 9:82886142-82886164 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1056323916 9:85461033-85461055 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1056363738 9:85883072-85883094 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1056522475 9:87413313-87413335 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1056777743 9:89526112-89526134 CCAGCCAGGCCCGGAGCCCCAGG + Intergenic
1056883007 9:90414962-90414984 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1056958636 9:91102408-91102430 TGAGCCACTCCCATAGCCACTGG + Intergenic
1057057163 9:91972407-91972429 TCAGGCACTCACAGAGTCCCAGG + Intergenic
1057234876 9:93349992-93350014 GCAGCCACTCCCAGAGCTCCTGG + Intergenic
1057378019 9:94542214-94542236 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1057501031 9:95596766-95596788 GCAGCTGCTCCCAGGGTCCCTGG + Intergenic
1057684029 9:97217230-97217252 GCAGCCACTCCCAGAGCTCCTGG + Intergenic
1057982110 9:99672545-99672567 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1058866624 9:109167093-109167115 GCAGCGACGCCCAGACCCCCGGG + Exonic
1059546132 9:115177943-115177965 GCAGCCACTTCCAGAGCCCCTGG - Intronic
1059574648 9:115475746-115475768 GCAGCCACTCCCACAGCCCCTGG + Intergenic
1059606679 9:115842528-115842550 GCAGCCACTCCCAGAGCCCCAGG - Intergenic
1059863458 9:118488997-118489019 GCAGCGACTCCCAGAGCCCCTGG - Intergenic
1060210996 9:121710324-121710346 GCAGCCCCCAGCAGAGCCCCGGG - Intronic
1060318443 9:122533957-122533979 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1060737850 9:126077951-126077973 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1060941448 9:127545285-127545307 GCCTCCACTCCCACAGCCCCTGG + Intronic
1061485864 9:130920161-130920183 GCCCCCACCCCCAGCGCCCCTGG - Intronic
1061583099 9:131549473-131549495 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1061927459 9:133812958-133812980 GCTGCCACTCACAGAGTCACTGG - Intronic
1062250752 9:135592444-135592466 GCAGCCAACCCCAGAGACGCGGG - Intergenic
1062273859 9:135721559-135721581 GGAGCCAATCCCAGAGCCTCGGG + Intronic
1062320840 9:135989914-135989936 GCAGCCTCCCCCAGGGCTCCAGG - Intergenic
1062454823 9:136630426-136630448 TCCCCCACTCCCAGAGCCCCTGG - Intergenic
1062585502 9:137247630-137247652 CCAGCCACCTCCAGAGCTCCCGG + Intronic
1062586375 9:137251700-137251722 GCAGCCACTGTCTCAGCCCCCGG - Intronic
1062645003 9:137543381-137543403 GCGGCAGCTCCCATAGCCCCGGG - Intronic
1202781138 9_KI270717v1_random:38853-38875 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1203468101 Un_GL000220v1:105265-105287 GCAGCCACACACGGAGCGCCCGG - Intergenic
1203475922 Un_GL000220v1:149237-149259 GCAGCCACACACGGAGCGCCCGG - Intergenic
1203581400 Un_KI270746v1:9234-9256 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1203587912 Un_KI270747v1:24456-24478 AGAGCCACTCTCAGAGACCCTGG + Intergenic
1203615419 Un_KI270749v1:58248-58270 AGAGCCACTCTCAGAGACCCTGG - Intergenic
1185603814 X:1355617-1355639 GCCGCCTCTCCCAGTGGCCCAGG - Intronic
1185699074 X:2216723-2216745 GCATCCTCTCCTAGAGCCTCTGG + Intergenic
1185706851 X:2273956-2273978 GCAGCCACGCGCAGGGGCCCTGG + Intronic
1185858400 X:3556447-3556469 GCAGCGACTCCCAGAGCCCCTGG - Intergenic
1185960663 X:4543807-4543829 GCAGCGACTCCCAGAGACCCTGG - Intergenic
1185991089 X:4893979-4894001 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1186112836 X:6275501-6275523 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1186238681 X:7542865-7542887 GCCAGCACTCCCAGGGCCCCTGG - Intergenic
1186530566 X:10290999-10291021 GCAGTCACTCCCCCAGCCCCTGG + Intergenic
1186709103 X:12173980-12174002 GCAGCCCCTGGAAGAGCCCCTGG - Intronic
1186784100 X:12942221-12942243 GCAGCCACTCCCAGAGACCCTGG + Intergenic
1186807530 X:13155070-13155092 GCAGCCACTTCCAGAGACTGTGG - Intergenic
1187086492 X:16048010-16048032 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1187099930 X:16182480-16182502 GCAGCCACTTCCAGAGCTCCTGG - Intergenic
1187103739 X:16220144-16220166 GCAGCCACTCCCAGAGCCGCTGG - Intergenic
1188332990 X:28895913-28895935 GGAGCCACTCCCAGAGCCCGTGG - Intronic
1188419513 X:29977662-29977684 GCCGCCACTCCCAGAGCCCCTGG + Intergenic
1188431053 X:30105731-30105753 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1188463347 X:30452417-30452439 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1188552682 X:31379892-31379914 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1188869991 X:35360689-35360711 TCAGGCACACCCAGAGACCCAGG - Intergenic
1188995288 X:36877495-36877517 CCTGCCCCTCCCAAAGCCCCTGG - Intergenic
1189031782 X:37459091-37459113 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1189333124 X:40155035-40155057 GCAGCTACTCCCCCAGCCCCGGG - Intronic
1189335835 X:40170239-40170261 GTAGCCATTCCCCCAGCCCCAGG - Intronic
1191014164 X:55791629-55791651 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1191805782 X:65132957-65132979 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1191825582 X:65362101-65362123 GCAGCCACTCCCAGAGTCCCTGG + Intergenic
1192395027 X:70771907-70771929 GGACCCACCCCCATAGCCCCAGG + Intronic
1192454622 X:71266570-71266592 GCAGCCACTCCTAGAGTCCCTGG + Intergenic
1192706167 X:73530053-73530075 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1192764560 X:74128136-74128158 GCTGCCACTCCTAAAGCTCCTGG - Intergenic
1192897441 X:75459183-75459205 TCAGCCACACACAGAGACCCAGG + Intronic
1192914103 X:75635588-75635610 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1192917899 X:75673556-75673578 CCAGCCACTCCCAGGGCTCCTGG + Intergenic
1193885957 X:86984193-86984215 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1193941527 X:87684277-87684299 ACAGCCACTCCCAGAGCTCCTGG + Intergenic
1194186220 X:90776640-90776662 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1194293595 X:92103558-92103580 GCAGCCACTCCCAGAGCTCCTGG - Intronic
1194308514 X:92276381-92276403 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1194351316 X:92826879-92826901 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1194367134 X:93025321-93025343 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1194502953 X:94702141-94702163 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1194660716 X:96626414-96626436 GTAGCCACTCCCAGAGCCCCTGG + Intergenic
1194822741 X:98527593-98527615 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1194873770 X:99162759-99162781 GCGGCCACTCCCAGAGCCCCTGG - Intergenic
1195016920 X:100789742-100789764 GCAGCCACTCCCAGATCCCCTGG - Intergenic
1195291125 X:103432851-103432873 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1195326829 X:103765097-103765119 GCAGCCACTCCCAGAGCCACTGG - Intergenic
1195546230 X:106115369-106115391 ACAGCCACTGCCAGAGCCATTGG + Intergenic
1195841516 X:109180809-109180831 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1195908649 X:109868537-109868559 GCAGCCACTCTCAGAGCCCCTGG - Intergenic
1196073109 X:111546305-111546327 GCAGCCATTCCCAGAGCCCCTGG + Intergenic
1196096890 X:111809520-111809542 GCAGCCACTGCCAGAGGTGCAGG + Intronic
1196165571 X:112533004-112533026 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1196220954 X:113112040-113112062 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1196227191 X:113180122-113180144 GCAGTCACTCCCAGAGCCCCTGG - Intergenic
1196300040 X:114042371-114042393 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1196330853 X:114469151-114469173 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1196341689 X:114604624-114604646 GCAGCCATTCCCAGAGCCCCTGG - Intronic
1196496895 X:116333211-116333233 GCAGCCACTCCCGGAGCCCCTGG + Intergenic
1196525443 X:116724272-116724294 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1196533515 X:116815801-116815823 GCAGCCACTCCCAGAGCTCCTGG - Intergenic
1196572527 X:117281547-117281569 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1196773826 X:119321087-119321109 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1196898712 X:120362384-120362406 GCAGTGACTCCCAGCACCCCCGG + Intronic
1196950819 X:120874828-120874850 GCAGCCCTGCCCAGAGCCCTTGG + Intronic
1196992658 X:121346311-121346333 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1197064946 X:122224423-122224445 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1197352028 X:125392167-125392189 GCAGCCACTCCCAGAACCCCTGG - Intergenic
1197470991 X:126865491-126865513 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1197499752 X:127228988-127229010 GTAGCCACTCTCAGAGACCCTGG + Intergenic
1197607122 X:128597527-128597549 GCAGCCATTACTATAGCCCCAGG - Intergenic
1197933113 X:131714460-131714482 GCAACCACTCCCAGAGCCCCTGG + Intergenic
1198486828 X:137095540-137095562 GGAGCCTGTCCCACAGCCCCCGG - Intergenic
1198599375 X:138267631-138267653 GCAGCCACTCCTAGAGCCCCTGG - Intergenic
1198965950 X:142228938-142228960 GCAACCACTCCCAGAGCCCCTGG + Intergenic
1198983725 X:142426887-142426909 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1199097376 X:143758751-143758773 GCAACCACACCCTGATCCCCAGG - Intergenic
1199576508 X:149318054-149318076 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1199711056 X:150469928-150469950 CCAGCCACTCCCATAGCCGCAGG - Exonic
1199742101 X:150745337-150745359 GCAGCCAAGGCCAGAGCTCCTGG - Intronic
1199974956 X:152888991-152889013 CCTCCCACTCTCAGAGCCCCTGG + Intergenic
1200007799 X:153099331-153099353 GCCGCCACTCCTAAAGCTCCTGG - Intergenic
1200047390 X:153410088-153410110 GGATCCACCCCCAGAGCCACCGG - Intergenic
1200103910 X:153701903-153701925 GCAGCCAGCCCCTGGGCCCCTGG + Intronic
1200224859 X:154411805-154411827 GCCGGCGCTCCCAGCGCCCCGGG - Exonic
1200532810 Y:4358719-4358741 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1200611114 Y:5328104-5328126 GCAGCCACTCCCAGAGCTCCTGG - Intronic
1200659641 Y:5943569-5943591 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1200675347 Y:6141577-6141599 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1201061630 Y:10051644-10051666 GCAGTCACTCCCAGAGCCCCTGG - Intergenic
1201234226 Y:11894456-11894478 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1201540613 Y:15101561-15101583 GCAACCACTCCCAGAGCCCTTGG - Intergenic
1201581416 Y:15514763-15514785 GAAGCCACTCCCATAGCCCCTGG + Intergenic
1201724789 Y:17140020-17140042 GAAGCCACTCCCAGAGCCCCTGG - Intergenic
1202047113 Y:20746371-20746393 GGTGCCACTCCCAAAGACCCTGG + Intergenic