ID: 1056062033

View in Genome Browser
Species Human (GRCh38)
Location 9:82893476-82893498
Sequence TATTCTGACATTCCATTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056062033_1056062039 29 Left 1056062033 9:82893476-82893498 CCTTTCAATGGAATGTCAGAATA No data
Right 1056062039 9:82893528-82893550 ATGTGCCTTTGTTTTTGACTAGG No data
1056062033_1056062038 4 Left 1056062033 9:82893476-82893498 CCTTTCAATGGAATGTCAGAATA No data
Right 1056062038 9:82893503-82893525 AGGGATTATCTAAACATACAGGG No data
1056062033_1056062037 3 Left 1056062033 9:82893476-82893498 CCTTTCAATGGAATGTCAGAATA No data
Right 1056062037 9:82893502-82893524 CAGGGATTATCTAAACATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056062033 Original CRISPR TATTCTGACATTCCATTGAA AGG (reversed) Intergenic
No off target data available for this crispr