ID: 1056062036 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:82893501-82893523 |
| Sequence | CTGTATGTTTAGATAATCCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1056062036_1056062039 | 4 | Left | 1056062036 | 9:82893501-82893523 | CCAGGGATTATCTAAACATACAG | No data | ||
| Right | 1056062039 | 9:82893528-82893550 | ATGTGCCTTTGTTTTTGACTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1056062036 | Original CRISPR | CTGTATGTTTAGATAATCCC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||