ID: 1056062036

View in Genome Browser
Species Human (GRCh38)
Location 9:82893501-82893523
Sequence CTGTATGTTTAGATAATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056062036_1056062039 4 Left 1056062036 9:82893501-82893523 CCAGGGATTATCTAAACATACAG No data
Right 1056062039 9:82893528-82893550 ATGTGCCTTTGTTTTTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056062036 Original CRISPR CTGTATGTTTAGATAATCCC TGG (reversed) Intergenic
No off target data available for this crispr