ID: 1056062039

View in Genome Browser
Species Human (GRCh38)
Location 9:82893528-82893550
Sequence ATGTGCCTTTGTTTTTGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056062033_1056062039 29 Left 1056062033 9:82893476-82893498 CCTTTCAATGGAATGTCAGAATA No data
Right 1056062039 9:82893528-82893550 ATGTGCCTTTGTTTTTGACTAGG No data
1056062036_1056062039 4 Left 1056062036 9:82893501-82893523 CCAGGGATTATCTAAACATACAG No data
Right 1056062039 9:82893528-82893550 ATGTGCCTTTGTTTTTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056062039 Original CRISPR ATGTGCCTTTGTTTTTGACT AGG Intergenic
No off target data available for this crispr