ID: 1056062231

View in Genome Browser
Species Human (GRCh38)
Location 9:82895656-82895678
Sequence TGGACCTGAACAATCTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056062231_1056062236 11 Left 1056062231 9:82895656-82895678 CCTATATAGATTGTTCAGGTCCA No data
Right 1056062236 9:82895690-82895712 CTGCTCTCCAACTTACATGTTGG No data
1056062231_1056062237 12 Left 1056062231 9:82895656-82895678 CCTATATAGATTGTTCAGGTCCA No data
Right 1056062237 9:82895691-82895713 TGCTCTCCAACTTACATGTTGGG No data
1056062231_1056062239 24 Left 1056062231 9:82895656-82895678 CCTATATAGATTGTTCAGGTCCA No data
Right 1056062239 9:82895703-82895725 TACATGTTGGGAAGCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056062231 Original CRISPR TGGACCTGAACAATCTATAT AGG (reversed) Intergenic
No off target data available for this crispr