ID: 1056062312

View in Genome Browser
Species Human (GRCh38)
Location 9:82896495-82896517
Sequence ATCAGCCTGTTGCTCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056062312_1056062314 4 Left 1056062312 9:82896495-82896517 CCCTCAGGGAGCAACAGGCTGAT No data
Right 1056062314 9:82896522-82896544 AAGACAAGCATGCAAATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056062312 Original CRISPR ATCAGCCTGTTGCTCCCTGA GGG (reversed) Intergenic
No off target data available for this crispr