ID: 1056068685

View in Genome Browser
Species Human (GRCh38)
Location 9:82963568-82963590
Sequence AGAACAATGATAAGGGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056068685_1056068691 18 Left 1056068685 9:82963568-82963590 CCATAAACCCTTATCATTGTTCT No data
Right 1056068691 9:82963609-82963631 CTCCTGGATCCTTCTCTGCTTGG No data
1056068685_1056068688 2 Left 1056068685 9:82963568-82963590 CCATAAACCCTTATCATTGTTCT No data
Right 1056068688 9:82963593-82963615 GACCCAATGTTTGTTTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056068685 Original CRISPR AGAACAATGATAAGGGTTTA TGG (reversed) Intergenic
No off target data available for this crispr