ID: 1056068686

View in Genome Browser
Species Human (GRCh38)
Location 9:82963575-82963597
Sequence GGGTCTAAGAACAATGATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056068686_1056068688 -5 Left 1056068686 9:82963575-82963597 CCCTTATCATTGTTCTTAGACCC No data
Right 1056068688 9:82963593-82963615 GACCCAATGTTTGTTTCTCCTGG No data
1056068686_1056068691 11 Left 1056068686 9:82963575-82963597 CCCTTATCATTGTTCTTAGACCC No data
Right 1056068691 9:82963609-82963631 CTCCTGGATCCTTCTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056068686 Original CRISPR GGGTCTAAGAACAATGATAA GGG (reversed) Intergenic
No off target data available for this crispr