ID: 1056068689

View in Genome Browser
Species Human (GRCh38)
Location 9:82963595-82963617
Sequence ATCCAGGAGAAACAAACATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056068689_1056068696 27 Left 1056068689 9:82963595-82963617 CCCAATGTTTGTTTCTCCTGGAT No data
Right 1056068696 9:82963645-82963667 TATTTTTCAGTCAACCCATAAGG No data
1056068689_1056068691 -9 Left 1056068689 9:82963595-82963617 CCCAATGTTTGTTTCTCCTGGAT No data
Right 1056068691 9:82963609-82963631 CTCCTGGATCCTTCTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056068689 Original CRISPR ATCCAGGAGAAACAAACATT GGG (reversed) Intergenic
No off target data available for this crispr