ID: 1056068691

View in Genome Browser
Species Human (GRCh38)
Location 9:82963609-82963631
Sequence CTCCTGGATCCTTCTCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056068686_1056068691 11 Left 1056068686 9:82963575-82963597 CCCTTATCATTGTTCTTAGACCC No data
Right 1056068691 9:82963609-82963631 CTCCTGGATCCTTCTCTGCTTGG No data
1056068685_1056068691 18 Left 1056068685 9:82963568-82963590 CCATAAACCCTTATCATTGTTCT No data
Right 1056068691 9:82963609-82963631 CTCCTGGATCCTTCTCTGCTTGG No data
1056068689_1056068691 -9 Left 1056068689 9:82963595-82963617 CCCAATGTTTGTTTCTCCTGGAT No data
Right 1056068691 9:82963609-82963631 CTCCTGGATCCTTCTCTGCTTGG No data
1056068690_1056068691 -10 Left 1056068690 9:82963596-82963618 CCAATGTTTGTTTCTCCTGGATC No data
Right 1056068691 9:82963609-82963631 CTCCTGGATCCTTCTCTGCTTGG No data
1056068687_1056068691 10 Left 1056068687 9:82963576-82963598 CCTTATCATTGTTCTTAGACCCA No data
Right 1056068691 9:82963609-82963631 CTCCTGGATCCTTCTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056068691 Original CRISPR CTCCTGGATCCTTCTCTGCT TGG Intergenic
No off target data available for this crispr