ID: 1056070046

View in Genome Browser
Species Human (GRCh38)
Location 9:82976897-82976919
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056070046_1056070049 8 Left 1056070046 9:82976897-82976919 CCTGGGCTTCAAAGAGGTCCGTG No data
Right 1056070049 9:82976928-82976950 ATCTTAAAACCCTGATCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056070046 Original CRISPR CACGGACCTCTTTGAAGCCC AGG (reversed) Intergenic
No off target data available for this crispr