ID: 1056070531

View in Genome Browser
Species Human (GRCh38)
Location 9:82982186-82982208
Sequence ATGAAGAAACAGATCCGACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056070527_1056070531 21 Left 1056070527 9:82982142-82982164 CCAAGGGCTGCAAGGCCTTTGAG 0: 1
1: 0
2: 0
3: 20
4: 226
Right 1056070531 9:82982186-82982208 ATGAAGAAACAGATCCGACATGG 0: 1
1: 0
2: 0
3: 11
4: 180
1056070530_1056070531 6 Left 1056070530 9:82982157-82982179 CCTTTGAGGGCAAGCTGCACATT 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1056070531 9:82982186-82982208 ATGAAGAAACAGATCCGACATGG 0: 1
1: 0
2: 0
3: 11
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056070531 Original CRISPR ATGAAGAAACAGATCCGACA TGG Exonic
902895508 1:19477046-19477068 ATGAGGAAACAGACCTCACAGGG + Intronic
903416225 1:23185071-23185093 ATGAGGAAACTGATCCCAGAAGG - Intergenic
903621348 1:24700613-24700635 ATGAAGACACTGATCTGACAAGG + Intergenic
904066750 1:27758191-27758213 ATGAGGAAACAGACCCGAAGAGG + Intronic
907132739 1:52110845-52110867 ATGAAGAAACATGTCTGACAGGG - Intergenic
909094918 1:71274672-71274694 ATGAAGAAACAGGGCAGACTGGG - Intergenic
909157289 1:72094075-72094097 CTGAAGTAAAAGATCAGACATGG + Intronic
910779817 1:90918013-90918035 ATGAAGAAACTGATCAGATTTGG + Intronic
912603115 1:110959298-110959320 ATGAAGAAACAGATTCAAAGAGG - Intronic
913360784 1:117977933-117977955 ATCAAGAATCAGATAAGACAGGG - Intronic
917099137 1:171428402-171428424 ATGAAGAGACAGATAGGATAAGG - Intergenic
923187106 1:231585065-231585087 ATGAAGACAGAGATCAGAGATGG - Intronic
1063088385 10:2839739-2839761 ATGAAGATACAGAACAGACCCGG - Intergenic
1063834893 10:10001533-10001555 ATGAAGACACAGAGCAGCCATGG - Intergenic
1064345435 10:14528528-14528550 ATGAAGAAACAGATCTCAAGAGG + Intronic
1064386775 10:14901304-14901326 ATGAAGAATCAAATCAGACTAGG + Intronic
1065346731 10:24755669-24755691 ATGAAGTTACAGAACCGATATGG + Intergenic
1066270004 10:33813127-33813149 ATGAAGAGACACATCAGACAAGG + Intergenic
1067352711 10:45491181-45491203 ATGAAGAAACAGGTCAGGTATGG - Intronic
1070827943 10:79401999-79402021 ATGTAGAAACAGAGGCCACAGGG + Intronic
1071801086 10:89061229-89061251 ATGAATAAAGAGACTCGACATGG + Intergenic
1074383417 10:112998290-112998312 TTAAAGAAACAGATCCAAAAAGG - Intronic
1075080025 10:119377204-119377226 CTGTTGAAACAGATCCGAAAGGG + Intronic
1076121139 10:127937469-127937491 ATGAAGAAACAGAGGCCCCAGGG + Intronic
1082032676 11:47616977-47616999 ATTAAGAAACACATGCGACCGGG - Intergenic
1083206526 11:61153043-61153065 ATGCAGAAACAAACACGACATGG - Intronic
1083562673 11:63685556-63685578 ATGAAGAAAAACATCCAGCAAGG - Intronic
1084344758 11:68539278-68539300 ATGAGGAAACAGACCCAAGAAGG - Intronic
1085018707 11:73191778-73191800 AGGAAGAAACAGAGCCCAGAGGG + Intergenic
1086363515 11:86084518-86084540 AGGAATAAACAGATCCAGCAGGG - Intergenic
1087572402 11:99945648-99945670 ATGAAGAAACAGAACTGAAGAGG + Intronic
1087783915 11:102332604-102332626 GTGAAGAAATAGATCCCAGATGG - Intronic
1091075903 11:132616498-132616520 ATTAAGAAACAGATCCTAGAAGG - Intronic
1092801722 12:12175096-12175118 ATGAAAAAACAGGTCGGGCATGG + Intronic
1093432865 12:19104005-19104027 ACAAAGAAACAGAACTGACAGGG + Intergenic
1095304606 12:40624879-40624901 ATGAAGAGACATATCAGACTAGG + Intergenic
1095474015 12:42566567-42566589 ATGAAGAAACAGGTTCCAAATGG - Intronic
1098807585 12:75039218-75039240 ATTAAGAAACAGCTCAGAAAAGG - Intergenic
1102428919 12:112866506-112866528 ATGAAAATTCAGATCCCACAGGG + Intronic
1103431937 12:120895135-120895157 ATGAAAAAACAGGTCGGGCATGG + Intronic
1105832555 13:24177128-24177150 ATTAAGAAACAGAATTGACAAGG - Intronic
1106549254 13:30757375-30757397 ATGAAGAAAGAGATGGCACAGGG - Intronic
1107558793 13:41542412-41542434 AGGAAAGAACACATCCGACAAGG - Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1112883106 13:104133840-104133862 ATGAAGAAACATAACAGCCAAGG + Intergenic
1114188151 14:20419298-20419320 ATGAAGAAAGAGGTCGGGCATGG - Intergenic
1115903368 14:38179397-38179419 ATGTAGAAAGAGATACCACAAGG + Intergenic
1120486558 14:85121532-85121554 ATGAAGAAACACATTCTAGAGGG - Intergenic
1123467912 15:20529829-20529851 ATGAAGAGACAGGGCCGACATGG - Intergenic
1123650201 15:22471213-22471235 ATGAAGAGACAGGGCCGACATGG + Intergenic
1123728226 15:23125038-23125060 GTGAAGAGACAGGGCCGACATGG - Intergenic
1123740607 15:23280055-23280077 GTGAAGAGACAGGGCCGACATGG + Intergenic
1123746391 15:23322503-23322525 GTGAAGAGACAGGGCCGACATGG - Intergenic
1124047040 15:26160065-26160087 ATGAAAACACAGATGCGAGAAGG + Intergenic
1124220394 15:27845960-27845982 ATGAAGACACAGCACAGACAGGG + Intronic
1124278658 15:28345820-28345842 GTGAAGAGACAGGGCCGACATGG - Intergenic
1124304042 15:28565788-28565810 GTGAAGAGACAGGGCCGACATGG + Intergenic
1126063702 15:44808774-44808796 ATGAGGAAACAGATCCCAAGAGG - Intergenic
1126711072 15:51456776-51456798 ATGAATAAACAGATACAAAATGG - Intronic
1127168532 15:56273954-56273976 ATGAAGCCACAGATACGAGAAGG - Intronic
1128286685 15:66442937-66442959 ATGAAGAGACACATAGGACAAGG + Intronic
1129826246 15:78636982-78637004 AAGAAGAAACAGAGCTGAGATGG + Intronic
1130353470 15:83110350-83110372 AGGAAGAAACAGGTCCTGCAGGG - Intronic
1131163922 15:90128693-90128715 ATGAAGAAACAGACCCTGCCTGG - Intergenic
1134039690 16:11059119-11059141 AGGAAGAAACAGAGCTGAGAGGG - Intronic
1134145282 16:11755807-11755829 ATGAAGACACAGAACAGAGAAGG + Intronic
1138879035 16:60988468-60988490 ATGAAGAACCAGGCCCGGCACGG + Intergenic
1140525747 16:75621454-75621476 ATGAGGAAACAGACCCAGCAAGG - Intronic
1144837123 17:18162425-18162447 TTGAGGAAACAGTTCAGACAGGG - Intronic
1144962195 17:19051078-19051100 ATGAAGAAACAGGCCAGGCATGG + Intergenic
1144972966 17:19123442-19123464 ATGAAGAAACAGGCCAGGCATGG - Intergenic
1146499954 17:33355722-33355744 ATGAATAAACAGATCTTACCAGG - Intronic
1147025176 17:37575891-37575913 GTGAAAAAAAAGATCCCACATGG + Intronic
1147358041 17:39912749-39912771 ATGAAGAAACAGATTCAAAGAGG - Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1148763510 17:50022019-50022041 CTGAAGAAAGGGATCAGACAGGG - Intergenic
1152413268 17:80142029-80142051 ATGAAGAAAGAGAGTAGACATGG + Intronic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153541263 18:6158688-6158710 CTGTAGAAAGAGATCCCACATGG + Intronic
1153703204 18:7717361-7717383 AAGAAGAATCAGATCAGAGACGG + Intronic
1161755216 19:6128445-6128467 ATTAAGAAACAGACGCCACATGG + Intronic
1163530058 19:17843644-17843666 ATGAGGAAACAGACCAGAGAGGG - Intronic
929728130 2:44454649-44454671 ATAGAGAAACAGATCAGAAATGG - Intronic
930062438 2:47301445-47301467 TTGCAGAAACAGCTCAGACAGGG - Intergenic
931024290 2:58091750-58091772 ATGAATAAACAGAACAGAGAAGG + Intronic
932626050 2:73296652-73296674 ATGAGGAAACAGATTCAAAAAGG + Intergenic
934147919 2:89113906-89113928 ATGCAGAAACATAACCGAAAAGG + Intergenic
934221361 2:90086702-90086724 ATGCAGAAACATAACCGAAAAGG - Intergenic
935447410 2:103171331-103171353 ATGAAGAATCAGATCACTCATGG - Intergenic
935449864 2:103196994-103197016 ATGAGGAAAAAAATCCCACATGG + Intergenic
936686238 2:114829879-114829901 AGGAAGAAAAAGAGACGACACGG - Intronic
938940938 2:136169071-136169093 AAGCAGAAGCAGATCAGACAAGG - Intergenic
943503853 2:188728479-188728501 ATGGAGAAACACATCCCAAAAGG + Intergenic
948027686 2:234790994-234791016 ATGAAGAAAAAGATTCTGCAAGG - Intergenic
1168894948 20:1317971-1317993 ATGGATAAACAGAGCCGAGAGGG - Intronic
1172312235 20:33927621-33927643 ATGAGGAAACAGATCATAGAGGG + Intergenic
1173180426 20:40802710-40802732 ATGCAGAAAGAGATAAGACAGGG - Intergenic
1181168919 22:20997528-20997550 CTGAAGACACAGGTCCCACAGGG + Exonic
1181454863 22:23053369-23053391 ATGAAGGAACTCATCAGACAGGG - Intergenic
1185186025 22:49400924-49400946 ATGAAGAAACAGCTCCCCCGAGG + Intergenic
951517765 3:23580653-23580675 ATGAACAAACAAATCAGAGATGG + Intronic
951692913 3:25416067-25416089 CTGAAGAAAAAGATGCAACAAGG + Intronic
951802980 3:26617258-26617280 ATTAAGAAAGAGATGCAACAAGG + Intergenic
953174262 3:40535219-40535241 GTGAAGAATCAGATACGGCAAGG - Exonic
956610184 3:71114699-71114721 AGGGAGAGACAGATTCGACAAGG + Intronic
957233315 3:77549870-77549892 ATGGAGAAACAGATCCCAGAGGG + Intronic
958259052 3:91358148-91358170 ATAAAGAATCAAATCTGACAAGG + Intergenic
958761390 3:98312642-98312664 ATAAAGAAACAGATAAGAGATGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959672087 3:108990127-108990149 ATAAAGAAAGAGATTCCACATGG - Intronic
961225705 3:125243814-125243836 ATCAAGAAACAGGTCAGACGTGG - Intronic
962565532 3:136655166-136655188 ATCAAGAAACAAATCCAACAGGG + Intronic
962613864 3:137104618-137104640 ATGCAGAAGTAGATCAGACATGG + Intergenic
966804435 3:183795633-183795655 ATTAATAAAAAGAACCGACAGGG + Intronic
967361895 3:188640558-188640580 AAAAAGAAACAGATCCCTCATGG + Intronic
967377197 3:188817793-188817815 GTGGAGAAACAGATACTACAGGG + Intronic
973781386 4:54291057-54291079 AAGAAGAAACAAATCAGCCAGGG - Intronic
975886260 4:78969016-78969038 ATGAAGAAACAGACCTGGCCAGG - Intergenic
976137349 4:81952898-81952920 ATGAAGAAAAAGACCTGAAATGG + Intronic
978067036 4:104417708-104417730 ATGAAGAAACAGATTCAAAGAGG + Intergenic
979121088 4:116902670-116902692 ATAAAGAAACAGGTTCAACAAGG + Intergenic
983461756 4:168033390-168033412 ATGAAAAAAAAAATCCTACATGG + Intergenic
985360609 4:189171739-189171761 CTGAAGAAACAGCTCCAGCATGG - Intergenic
986523719 5:8649677-8649699 TTCAAGAAAAAGATCCGACTGGG - Intergenic
986674572 5:10171778-10171800 ATGAAGAAACAGCTCTCACTAGG + Intergenic
987259796 5:16191912-16191934 ATGAGGAACCTGATCAGACATGG - Intergenic
991435272 5:66591855-66591877 AATAAGAAACAGGTCCAACAAGG + Intergenic
993491151 5:88551689-88551711 ATGAAGAAACAAATACAAAAGGG - Intergenic
996579259 5:125012457-125012479 ATGAAGAATCAAATCTGATATGG - Intergenic
997590303 5:135068162-135068184 ATGAAGAAGCAGATCAGGCCAGG - Intronic
998924860 5:147111634-147111656 TTGAAGGAGCAGATCCCACAAGG - Intergenic
1000402581 5:160846804-160846826 AGGAAGAGACAGAGCCAACATGG - Intronic
1000692183 5:164337619-164337641 ATGAAGAAATACATGAGACATGG + Intergenic
1000822616 5:166003286-166003308 ATGAAGAAATAAAGCAGACATGG + Intergenic
1003236010 6:4295623-4295645 CTGATGAATCAGATCCTACAGGG + Intergenic
1004357874 6:14945718-14945740 AAGAAGAAAGAGATCAGAGATGG + Intergenic
1005008621 6:21314379-21314401 ATGAAGAAAAAGAGCCACCAGGG + Intergenic
1007744745 6:44036648-44036670 ATGAAGAAACAGACTCTAGATGG + Intergenic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1008996205 6:57662439-57662461 ATAAAGAATCAAATCTGACAAGG - Intergenic
1009184732 6:60561222-60561244 ATAAAGAATCAAATCTGACAAGG - Intergenic
1009820765 6:68798279-68798301 ATGAAGATACAGAACAGACTTGG - Intronic
1012334493 6:98038109-98038131 ATGAGGAAACAGATCTGAAGAGG + Intergenic
1014149568 6:118038269-118038291 ATGAAGAAAAAAATCAGAAATGG - Intronic
1015113727 6:129622127-129622149 ATGGAGACACACATCCTACAGGG + Intronic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1016066131 6:139685048-139685070 ATGAAGAAAAAGATACTTCAAGG - Intergenic
1016469797 6:144363421-144363443 ACAAAGAAACAGGTCCGACCAGG - Intronic
1016909949 6:149188842-149188864 ATGAAGAAAAAAAACCCACAGGG - Intergenic
1018097659 6:160405804-160405826 ATGAAGAAACTGATCTGGAAAGG + Intronic
1018449724 6:163896470-163896492 ATGAAAAAACAAATCAGACGAGG + Intergenic
1019026252 6:168965706-168965728 ATGAAGAAACAGACCCAAAGAGG + Intergenic
1019318947 7:406144-406166 AGGAAGAAGCAGATCCAGCAAGG + Intergenic
1020472680 7:8556932-8556954 ATGAAGAAACAGATACGATGAGG + Intronic
1020650969 7:10875723-10875745 ATGAAGAAACAGTGCCCACTCGG + Intergenic
1021481731 7:21125418-21125440 AAGAAGAAACGGTTCAGACAGGG + Intergenic
1022252621 7:28623590-28623612 TTAAAGAAACAGATTCTACAGGG + Intronic
1023490478 7:40734427-40734449 ATGAAGACACAGATCTGAGGAGG - Intronic
1027710699 7:81597771-81597793 ATTATGAAACAGATCCAATAAGG - Intergenic
1029616979 7:101665216-101665238 AAGAAGAAAAAGATCAGAGAGGG + Intergenic
1030371136 7:108700410-108700432 ATGAAGAAACACCTCAGACTGGG - Intergenic
1031909404 7:127499189-127499211 ATGAAGAAACAGAAACCATATGG - Intergenic
1032205717 7:129863395-129863417 GTAAAGAAACAGACCCCACAAGG - Intronic
1032419556 7:131766916-131766938 ATGAAGAAACTGAGACAACAGGG + Intergenic
1039405677 8:37310343-37310365 ATGAAGAAACAAATTCCAAAAGG + Intergenic
1042005144 8:64171516-64171538 ATGAAGAACCAGAGCAGACCAGG - Intergenic
1042803568 8:72747030-72747052 ATGTAGAAAGACAACCGACATGG + Intronic
1043177049 8:77034837-77034859 AAGAAGAAACAGAGCACACAAGG - Intergenic
1044118174 8:88360348-88360370 ATGAAGAAATAAAACCCACAAGG - Intergenic
1047274472 8:123395539-123395561 ATGAAGAAACGGATTCAAAAAGG - Intronic
1047701360 8:127452502-127452524 AGGAAGAAACAGATCCAGAAAGG - Intergenic
1048061217 8:130921019-130921041 CTGGAGAAACAGAACCAACAGGG - Intronic
1048781378 8:138006031-138006053 CTGAAGTAACAGTTCTGACATGG + Intergenic
1050169278 9:2798364-2798386 TTGAAGAAACAGACAAGACATGG - Intronic
1050710899 9:8462040-8462062 ATGAAGAGACAGATTCTGCATGG - Intronic
1051025814 9:12609794-12609816 ACAAAGAAACAGATCCTAGAGGG - Intergenic
1052419224 9:28220793-28220815 ATGGAGATACAGATCTGGCATGG - Intronic
1053418950 9:37964811-37964833 ATGAAGAAACAGAGACAACTTGG + Intronic
1055523841 9:77110140-77110162 ATGAAGAGACACATAGGACAAGG + Intergenic
1056070531 9:82982186-82982208 ATGAAGAAACAGATCCGACATGG + Exonic
1056701680 9:88916417-88916439 TTGCATAAACAGATCCGACTGGG + Intergenic
1057289522 9:93794478-93794500 ATAAAGAAATAGATCAGAAAGGG + Intergenic
1058956020 9:109949542-109949564 ATGAAGAAATAGCTCAGTCAAGG - Intronic
1059122938 9:111658919-111658941 ATGAGGAAACAGATCCACTAAGG - Intronic
1059354504 9:113688197-113688219 AAGAGGAAACAGATCGGAGAGGG - Intergenic
1062570778 9:137184205-137184227 ATGCAGACACAGAGCCGACATGG + Intronic
1062570788 9:137184249-137184271 ATGCAGACACAGAGCAGACACGG + Intronic
1188390344 X:29611732-29611754 AGGAAGAATCAGGTCAGACATGG + Intronic
1192124105 X:68485349-68485371 ATGCAGAAACCGGTCTGACACGG - Intergenic
1192252656 X:69425630-69425652 ATGAAGATACAGATTGGAGAGGG - Intergenic
1192743445 X:73915352-73915374 AGGAGGAAGCAGATCCCACATGG - Intergenic
1198331372 X:135626069-135626091 AGGAAGAAGCAGATCTGCCAGGG + Intergenic